\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101176877:

Variant ID: vg1101176877 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1176877
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GACCTTTTGTACTCTCTAAATTTTGTTCTTTGTTAATTCAATCAAACATGTACTAGGCAACTGCCGGACTCAGACTTATTGGAGATGAAAAGGCGAACCA[A/G]
ATTCTTGAAGCGGTACGTGCAATTCCACAATGATATACATCATATCATACAATTTTTTTAACTCAAAACCATTTCTTGCTTTGATTCTTAATAAATTTTT

Reverse complement sequence

AAAAATTTATTAAGAATCAAAGCAAGAAATGGTTTTGAGTTAAAAAAATTGTATGATATGATGTATATCATTGTGGAATTGCACGTACCGCTTCAAGAAT[T/C]
TGGTTCGCCTTTTCATCTCCAATAAGTCTGAGTCCGGCAGTTGCCTAGTACATGTTTGATTGAATTAACAAAGAACAAAATTTAGAGAGTACAAAAGGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 30.20% 2.92% 0.47% NA
All Indica  2759 94.60% 4.20% 1.09% 0.07% NA
All Japonica  1512 17.50% 81.90% 0.60% 0.00% NA
Aus  269 71.40% 5.60% 20.82% 2.23% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 86.20% 12.00% 1.72% 0.00% NA
Indica III  913 97.40% 1.30% 1.31% 0.00% NA
Indica Intermediate  786 93.50% 5.00% 1.27% 0.25% NA
Temperate Japonica  767 9.30% 90.20% 0.52% 0.00% NA
Tropical Japonica  504 29.00% 70.60% 0.40% 0.00% NA
Japonica Intermediate  241 19.50% 79.30% 1.24% 0.00% NA
VI/Aromatic  96 24.00% 19.80% 41.67% 14.58% NA
Intermediate  90 55.60% 41.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101176877 A -> DEL LOC_Os11g03230.2 N frameshift_variant Average:29.524; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1101176877 A -> DEL LOC_Os11g03230.1 N frameshift_variant Average:29.524; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1101176877 A -> G LOC_Os11g03230.1 synonymous_variant ; p.Gln139Gln; LOW synonymous_codon Average:29.524; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1101176877 A -> G LOC_Os11g03230.2 synonymous_variant ; p.Gln139Gln; LOW synonymous_codon Average:29.524; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101176877 NA 1.32E-09 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.05E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 3.19E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 3.35E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 3.09E-10 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 9.14E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 9.83E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 5.68E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.01E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 3.44E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 7.15E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 3.25E-07 NA mr1204 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 1.47E-28 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 1.88E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.53E-09 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 1.14E-23 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 3.34E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 6.67E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 4.22E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 5.55E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 7.08E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.75E-08 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 7.78E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.05E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 3.73E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 3.50E-35 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 1.03E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 1.12E-09 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.44E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.40E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 1.63E-11 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 2.90E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101176877 NA 7.37E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251