Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101084691:

Variant ID: vg1101084691 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1084691
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.37, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CACTAATAAAAGTATCAACTGAAATAACGTTTTCAAAATCACATAGATTCTAGCATAAAATTTCGTAGGTACTACACCATCCAAACTGGAATAAAAGCTC[C/T]
GTGGCTACCAATTCCAAGAGTGCAACACCAGTACGCATAGCATCATGTTGTTCCTGTGAAAGCATCATACACCAAGAGTGAAGTCGATTGGAACACATAA

Reverse complement sequence

TTATGTGTTCCAATCGACTTCACTCTTGGTGTATGATGCTTTCACAGGAACAACATGATGCTATGCGTACTGGTGTTGCACTCTTGGAATTGGTAGCCAC[G/A]
GAGCTTTTATTCCAGTTTGGATGGTGTAGTACCTACGAAATTTTATGCTAGAATCTATGTGATTTTGAAAACGTTATTTCAGTTGATACTTTTATTAGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	38.70%	0.13%	0.04%	NA
All Indica	2759	94.30%	5.40%	0.18%	0.07%	NA
All Japonica	1512	2.10%	97.80%	0.07%	0.00%	NA
Aus	269	54.30%	45.70%	0.00%	0.00%	NA
Indica I	595	99.00%	0.70%	0.17%	0.17%	NA
Indica II	465	85.80%	13.50%	0.43%	0.22%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.60%	0.25%	0.00%	NA
Temperate Japonica	767	2.60%	97.40%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.20%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101084691	C -> T	LOC_Os11g03060.1	upstream_gene_variant ; 2279.0bp to feature; MODIFIER	silent_mutation	Average:37.329; most accessible tissue: Callus, score: 65.653	N	N	N	N
vg1101084691	C -> T	LOC_Os11g03070.1	upstream_gene_variant ; 919.0bp to feature; MODIFIER	silent_mutation	Average:37.329; most accessible tissue: Callus, score: 65.653	N	N	N	N
vg1101084691	C -> T	LOC_Os11g03080.1	upstream_gene_variant ; 4806.0bp to feature; MODIFIER	silent_mutation	Average:37.329; most accessible tissue: Callus, score: 65.653	N	N	N	N
vg1101084691	C -> T	LOC_Os11g03060.2	upstream_gene_variant ; 3589.0bp to feature; MODIFIER	silent_mutation	Average:37.329; most accessible tissue: Callus, score: 65.653	N	N	N	N
vg1101084691	C -> T	LOC_Os11g03060-LOC_Os11g03070	intergenic_region ; MODIFIER	silent_mutation	Average:37.329; most accessible tissue: Callus, score: 65.653	N	N	N	N
vg1101084691	C -> DEL	N	N	silent_mutation	Average:37.329; most accessible tissue: Callus, score: 65.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101084691	NA	2.36E-38	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.62E-29	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	7.56E-43	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	9.69E-42	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	4.24E-56	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.42E-29	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.45E-50	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.12E-33	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	3.59E-39	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	5.93E-34	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	2.53E-34	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.40E-25	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	2.48E-31	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	7.66E-24	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	2.30E-30	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.52E-37	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	9.69E-40	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	3.46E-53	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.05E-11	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.83E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.66E-57	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	4.51E-45	mr1070_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.30E-31	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	2.82E-52	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.75E-58	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.05E-37	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.10E-44	mr1226_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	3.11E-41	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	3.26E-39	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.53E-21	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	3.65E-36	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	4.39E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.86E-39	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	3.67E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.51E-62	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691	NA	1.85E-15	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251