\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101084691:

Variant ID: vg1101084691 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1084691
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.37, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CACTAATAAAAGTATCAACTGAAATAACGTTTTCAAAATCACATAGATTCTAGCATAAAATTTCGTAGGTACTACACCATCCAAACTGGAATAAAAGCTC[C/T]
GTGGCTACCAATTCCAAGAGTGCAACACCAGTACGCATAGCATCATGTTGTTCCTGTGAAAGCATCATACACCAAGAGTGAAGTCGATTGGAACACATAA

Reverse complement sequence

TTATGTGTTCCAATCGACTTCACTCTTGGTGTATGATGCTTTCACAGGAACAACATGATGCTATGCGTACTGGTGTTGCACTCTTGGAATTGGTAGCCAC[G/A]
GAGCTTTTATTCCAGTTTGGATGGTGTAGTACCTACGAAATTTTATGCTAGAATCTATGTGATTTTGAAAACGTTATTTCAGTTGATACTTTTATTAGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.70% 0.13% 0.04% NA
All Indica  2759 94.30% 5.40% 0.18% 0.07% NA
All Japonica  1512 2.10% 97.80% 0.07% 0.00% NA
Aus  269 54.30% 45.70% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.17% 0.17% NA
Indica II  465 85.80% 13.50% 0.43% 0.22% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.60% 0.25% 0.00% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101084691 C -> T LOC_Os11g03060.1 upstream_gene_variant ; 2279.0bp to feature; MODIFIER silent_mutation Average:37.329; most accessible tissue: Callus, score: 65.653 N N N N
vg1101084691 C -> T LOC_Os11g03070.1 upstream_gene_variant ; 919.0bp to feature; MODIFIER silent_mutation Average:37.329; most accessible tissue: Callus, score: 65.653 N N N N
vg1101084691 C -> T LOC_Os11g03080.1 upstream_gene_variant ; 4806.0bp to feature; MODIFIER silent_mutation Average:37.329; most accessible tissue: Callus, score: 65.653 N N N N
vg1101084691 C -> T LOC_Os11g03060.2 upstream_gene_variant ; 3589.0bp to feature; MODIFIER silent_mutation Average:37.329; most accessible tissue: Callus, score: 65.653 N N N N
vg1101084691 C -> T LOC_Os11g03060-LOC_Os11g03070 intergenic_region ; MODIFIER silent_mutation Average:37.329; most accessible tissue: Callus, score: 65.653 N N N N
vg1101084691 C -> DEL N N silent_mutation Average:37.329; most accessible tissue: Callus, score: 65.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101084691 NA 2.36E-38 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.62E-29 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 7.56E-43 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 9.69E-42 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 4.24E-56 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.42E-29 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.45E-50 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.12E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 3.59E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 5.93E-34 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 2.53E-34 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.40E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 2.48E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 7.66E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 2.30E-30 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.52E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 9.69E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 3.46E-53 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.05E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.83E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.66E-57 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 4.51E-45 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.30E-31 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 2.82E-52 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.75E-58 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.05E-37 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.10E-44 mr1226_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 3.11E-41 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 3.26E-39 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.53E-21 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 3.65E-36 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 4.39E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.86E-39 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 3.67E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.51E-62 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101084691 NA 1.85E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251