Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100919003:

Variant ID: vg1100919003 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 919003
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCTTGCCTCGCTCGAGATCTTGAGCTTGATCCTCGGAATCCTCGCATTGCGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGAACAACTCAACAAAC[G/A]
GCAAAAATAAAGTCCTATTATTGACCTCTAAGCGTGCCATTAAATGGATCTCGAGATTTGAGGAATTTTGGAAGTTGAACGGAGTCAAACGGACTTACGG

Reverse complement sequence

CCGTAAGTCCGTTTGACTCCGTTCAACTTCCAAAATTCCTCAAATCTCGAGATCCATTTAATGGCACGCTTAGAGGTCAATAATAGGACTTTATTTTTGC[C/T]
GTTTGTTGAGTTGTTCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGCAATGCGAGGATTCCGAGGATCAAGCTCAAGATCTCGAGCGAGGCAAGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	4.80%	12.02%	39.46%	NA
All Indica	2759	19.50%	0.30%	18.09%	62.16%	NA
All Japonica	1512	86.80%	9.30%	2.18%	1.72%	NA
Aus	269	50.60%	2.60%	10.78%	36.06%	NA
Indica I	595	9.10%	0.30%	11.43%	79.16%	NA
Indica II	465	19.60%	0.00%	13.76%	66.67%	NA
Indica III	913	29.40%	0.10%	22.67%	47.86%	NA
Indica Intermediate	786	15.80%	0.60%	20.36%	63.23%	NA
Temperate Japonica	767	88.90%	6.60%	1.96%	2.48%	NA
Tropical Japonica	504	89.70%	8.30%	1.59%	0.40%	NA
Japonica Intermediate	241	73.90%	19.90%	4.15%	2.07%	NA
VI/Aromatic	96	27.10%	67.70%	0.00%	5.21%	NA
Intermediate	90	61.10%	6.70%	7.78%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100919003	G -> A	LOC_Os11g02778.1	upstream_gene_variant ; 1519.0bp to feature; MODIFIER	silent_mutation	Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg1100919003	G -> A	LOC_Os11g02780.1	downstream_gene_variant ; 2116.0bp to feature; MODIFIER	silent_mutation	Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg1100919003	G -> A	LOC_Os11g02778-LOC_Os11g02780	intergenic_region ; MODIFIER	silent_mutation	Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg1100919003	G -> DEL	N	N	silent_mutation	Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100919003	NA	1.87E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	5.82E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	6.04E-06	mr1931	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	3.33E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	2.64E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	8.70E-06	NA	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	7.65E-07	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	5.33E-06	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	6.40E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	2.95E-07	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	6.89E-06	mr1728_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	3.78E-06	NA	mr1733_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	1.58E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	1.55E-06	NA	mr1807_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	3.99E-07	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003	NA	4.46E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251