\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100919003:

Variant ID: vg1100919003 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 919003
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTTGCCTCGCTCGAGATCTTGAGCTTGATCCTCGGAATCCTCGCATTGCGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGAACAACTCAACAAAC[G/A]
GCAAAAATAAAGTCCTATTATTGACCTCTAAGCGTGCCATTAAATGGATCTCGAGATTTGAGGAATTTTGGAAGTTGAACGGAGTCAAACGGACTTACGG

Reverse complement sequence

CCGTAAGTCCGTTTGACTCCGTTCAACTTCCAAAATTCCTCAAATCTCGAGATCCATTTAATGGCACGCTTAGAGGTCAATAATAGGACTTTATTTTTGC[C/T]
GTTTGTTGAGTTGTTCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGCAATGCGAGGATTCCGAGGATCAAGCTCAAGATCTCGAGCGAGGCAAGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.70% 4.80% 12.02% 39.46% NA
All Indica  2759 19.50% 0.30% 18.09% 62.16% NA
All Japonica  1512 86.80% 9.30% 2.18% 1.72% NA
Aus  269 50.60% 2.60% 10.78% 36.06% NA
Indica I  595 9.10% 0.30% 11.43% 79.16% NA
Indica II  465 19.60% 0.00% 13.76% 66.67% NA
Indica III  913 29.40% 0.10% 22.67% 47.86% NA
Indica Intermediate  786 15.80% 0.60% 20.36% 63.23% NA
Temperate Japonica  767 88.90% 6.60% 1.96% 2.48% NA
Tropical Japonica  504 89.70% 8.30% 1.59% 0.40% NA
Japonica Intermediate  241 73.90% 19.90% 4.15% 2.07% NA
VI/Aromatic  96 27.10% 67.70% 0.00% 5.21% NA
Intermediate  90 61.10% 6.70% 7.78% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100919003 G -> A LOC_Os11g02778.1 upstream_gene_variant ; 1519.0bp to feature; MODIFIER silent_mutation Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1100919003 G -> A LOC_Os11g02780.1 downstream_gene_variant ; 2116.0bp to feature; MODIFIER silent_mutation Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1100919003 G -> A LOC_Os11g02778-LOC_Os11g02780 intergenic_region ; MODIFIER silent_mutation Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1100919003 G -> DEL N N silent_mutation Average:23.233; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100919003 NA 1.87E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 5.82E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 6.04E-06 mr1931 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 3.33E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 2.64E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 8.70E-06 NA mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 7.65E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 5.33E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 6.40E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 2.95E-07 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 6.89E-06 mr1728_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 3.78E-06 NA mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 1.58E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 1.55E-06 NA mr1807_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 3.99E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100919003 NA 4.46E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251