Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100184405:

Variant ID: vg1100184405 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 184405
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTTCTCTAAATGCCCAGCAAAAATAAACATTTGTTAATGAAATTAATTTACATAGCTGAAAGACCAAGAAAAGCTATAGAGGGGGGTGAATATAGCA[A/G]
TTCAAATCTTGCCCCCGAAAATACTCATCAAGCCTGATTTCTCAAAATCCTTACTAGAACTGCGGCTATTAGAGAAGCCGGATCTAGAAAAGAAGAGAGA

Reverse complement sequence

TCTCTCTTCTTTTCTAGATCCGGCTTCTCTAATAGCCGCAGTTCTAGTAAGGATTTTGAGAAATCAGGCTTGATGAGTATTTTCGGGGGCAAGATTTGAA[T/C]
TGCTATATTCACCCCCCTCTATAGCTTTTCTTGGTCTTTCAGCTATGTAAATTAATTTCATTAACAAATGTTTATTTTTGCTGGGCATTTAGAGAAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	5.60%	1.52%	2.60%	NA
All Indica	2759	91.90%	6.20%	1.01%	0.94%	NA
All Japonica	1512	94.00%	5.30%	0.73%	0.00%	NA
Aus	269	55.40%	0.40%	10.78%	33.46%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	68.60%	29.00%	2.37%	0.00%	NA
Indica III	913	98.60%	0.00%	0.55%	0.88%	NA
Indica Intermediate	786	92.10%	4.50%	1.15%	2.29%	NA
Temperate Japonica	767	98.40%	1.20%	0.39%	0.00%	NA
Tropical Japonica	504	86.90%	11.90%	1.19%	0.00%	NA
Japonica Intermediate	241	94.60%	4.60%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	1.04%	5.21%	NA
Intermediate	90	78.90%	15.60%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100184405	A -> DEL	N	N	silent_mutation	Average:35.622; most accessible tissue: Zhenshan97 flower, score: 56.847	N	N	N	N
vg1100184405	A -> G	LOC_Os11g01320.1	downstream_gene_variant ; 4319.0bp to feature; MODIFIER	silent_mutation	Average:35.622; most accessible tissue: Zhenshan97 flower, score: 56.847	N	N	N	N
vg1100184405	A -> G	LOC_Os11g01320-LOC_Os11g01330	intergenic_region ; MODIFIER	silent_mutation	Average:35.622; most accessible tissue: Zhenshan97 flower, score: 56.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100184405	NA	2.21E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	1.09E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	4.22E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	7.12E-06	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	7.99E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	8.30E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	3.90E-15	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	7.10E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	4.91E-15	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	1.09E-07	NA	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	1.68E-17	mr1903	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	1.75E-19	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	8.29E-17	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	3.87E-15	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	2.04E-08	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	1.04E-07	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	3.69E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	2.09E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	4.31E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	9.32E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	3.05E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	2.17E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	2.17E-06	3.74E-20	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	4.86E-14	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	7.23E-18	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405	NA	1.23E-14	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251