\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100184405:

Variant ID: vg1100184405 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 184405
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTTCTCTAAATGCCCAGCAAAAATAAACATTTGTTAATGAAATTAATTTACATAGCTGAAAGACCAAGAAAAGCTATAGAGGGGGGTGAATATAGCA[A/G]
TTCAAATCTTGCCCCCGAAAATACTCATCAAGCCTGATTTCTCAAAATCCTTACTAGAACTGCGGCTATTAGAGAAGCCGGATCTAGAAAAGAAGAGAGA

Reverse complement sequence

TCTCTCTTCTTTTCTAGATCCGGCTTCTCTAATAGCCGCAGTTCTAGTAAGGATTTTGAGAAATCAGGCTTGATGAGTATTTTCGGGGGCAAGATTTGAA[T/C]
TGCTATATTCACCCCCCTCTATAGCTTTTCTTGGTCTTTCAGCTATGTAAATTAATTTCATTAACAAATGTTTATTTTTGCTGGGCATTTAGAGAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 5.60% 1.52% 2.60% NA
All Indica  2759 91.90% 6.20% 1.01% 0.94% NA
All Japonica  1512 94.00% 5.30% 0.73% 0.00% NA
Aus  269 55.40% 0.40% 10.78% 33.46% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 68.60% 29.00% 2.37% 0.00% NA
Indica III  913 98.60% 0.00% 0.55% 0.88% NA
Indica Intermediate  786 92.10% 4.50% 1.15% 2.29% NA
Temperate Japonica  767 98.40% 1.20% 0.39% 0.00% NA
Tropical Japonica  504 86.90% 11.90% 1.19% 0.00% NA
Japonica Intermediate  241 94.60% 4.60% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 78.90% 15.60% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100184405 A -> DEL N N silent_mutation Average:35.622; most accessible tissue: Zhenshan97 flower, score: 56.847 N N N N
vg1100184405 A -> G LOC_Os11g01320.1 downstream_gene_variant ; 4319.0bp to feature; MODIFIER silent_mutation Average:35.622; most accessible tissue: Zhenshan97 flower, score: 56.847 N N N N
vg1100184405 A -> G LOC_Os11g01320-LOC_Os11g01330 intergenic_region ; MODIFIER silent_mutation Average:35.622; most accessible tissue: Zhenshan97 flower, score: 56.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100184405 NA 2.21E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 1.09E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 4.22E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 7.12E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 7.99E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 8.30E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 3.90E-15 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 7.10E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 4.91E-15 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 1.09E-07 NA mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 1.68E-17 mr1903 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 1.75E-19 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 8.29E-17 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 3.87E-15 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 2.04E-08 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 1.04E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 3.69E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 2.09E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 4.31E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 9.32E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 3.05E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 2.17E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 2.17E-06 3.74E-20 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 4.86E-14 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 7.23E-18 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100184405 NA 1.23E-14 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251