\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1023155972:

Variant ID: vg1023155972 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 23155972
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTACTTCCTTTAGGAAGCCAAAAAATATATTATTTATATAGTGTTTACAGGCAGATGCGTTAAAAAATAATGTAGCAGTTAACCGTTGCAATTCCTGTTG[C/T]
GGCAACGTTGTCGCTTTATCCTTAAAGAACAGAGACACAAGTAAGGAAATTTTCATGCGTTTCATCAAACTTCACTAGAGAGAATGGATCCATCCATCCA

Reverse complement sequence

TGGATGGATGGATCCATTCTCTCTAGTGAAGTTTGATGAAACGCATGAAAATTTCCTTACTTGTGTCTCTGTTCTTTAAGGATAAAGCGACAACGTTGCC[G/A]
CAACAGGAATTGCAACGGTTAACTGCTACATTATTTTTTAACGCATCTGCCTGTAAACACTATATAAATAATATATTTTTTGGCTTCCTAAAGGAAGTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 30.90% 0.23% 0.00% NA
All Indica  2759 97.50% 2.50% 0.04% 0.00% NA
All Japonica  1512 15.70% 83.90% 0.46% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 2.60% 97.10% 0.26% 0.00% NA
Tropical Japonica  504 35.90% 63.30% 0.79% 0.00% NA
Japonica Intermediate  241 14.90% 84.60% 0.41% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1023155972 C -> T LOC_Os10g42950.1 upstream_gene_variant ; 2712.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42960.1 upstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42950.3 upstream_gene_variant ; 2750.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42950.2 upstream_gene_variant ; 2712.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42950.4 upstream_gene_variant ; 2712.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42950.5 upstream_gene_variant ; 2712.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42970.1 downstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42970.2 downstream_gene_variant ; 4449.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1023155972 C -> T LOC_Os10g42950-LOC_Os10g42960 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1023155972 NA 1.12E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972 7.11E-07 7.11E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972 NA 7.98E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972 2.29E-06 2.29E-06 mr1264_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972 NA 8.19E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972 NA 2.29E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251