Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1023155972:

Variant ID: vg1023155972 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 23155972
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CTACTTCCTTTAGGAAGCCAAAAAATATATTATTTATATAGTGTTTACAGGCAGATGCGTTAAAAAATAATGTAGCAGTTAACCGTTGCAATTCCTGTTG[C/T]
GGCAACGTTGTCGCTTTATCCTTAAAGAACAGAGACACAAGTAAGGAAATTTTCATGCGTTTCATCAAACTTCACTAGAGAGAATGGATCCATCCATCCA

Reverse complement sequence

TGGATGGATGGATCCATTCTCTCTAGTGAAGTTTGATGAAACGCATGAAAATTTCCTTACTTGTGTCTCTGTTCTTTAAGGATAAAGCGACAACGTTGCC[G/A]
CAACAGGAATTGCAACGGTTAACTGCTACATTATTTTTTAACGCATCTGCCTGTAAACACTATATAAATAATATATTTTTTGGCTTCCTAAAGGAAGTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	30.90%	0.23%	0.00%	NA
All Indica	2759	97.50%	2.50%	0.04%	0.00%	NA
All Japonica	1512	15.70%	83.90%	0.46%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	2.60%	97.10%	0.26%	0.00%	NA
Tropical Japonica	504	35.90%	63.30%	0.79%	0.00%	NA
Japonica Intermediate	241	14.90%	84.60%	0.41%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	48.90%	47.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1023155972	C -> T	LOC_Os10g42950.1	upstream_gene_variant ; 2712.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42960.1	upstream_gene_variant ; 910.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42950.3	upstream_gene_variant ; 2750.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42950.2	upstream_gene_variant ; 2712.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42950.4	upstream_gene_variant ; 2712.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42950.5	upstream_gene_variant ; 2712.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42970.1	downstream_gene_variant ; 4494.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42970.2	downstream_gene_variant ; 4449.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1023155972	C -> T	LOC_Os10g42950-LOC_Os10g42960	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1023155972	NA	1.12E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972	7.11E-07	7.11E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972	NA	7.98E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972	2.29E-06	2.29E-06	mr1264_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972	NA	8.19E-06	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1023155972	NA	2.29E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251