\
| Variant ID: vg1023155972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 23155972 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 232. )
CTACTTCCTTTAGGAAGCCAAAAAATATATTATTTATATAGTGTTTACAGGCAGATGCGTTAAAAAATAATGTAGCAGTTAACCGTTGCAATTCCTGTTG[C/T]
GGCAACGTTGTCGCTTTATCCTTAAAGAACAGAGACACAAGTAAGGAAATTTTCATGCGTTTCATCAAACTTCACTAGAGAGAATGGATCCATCCATCCA
TGGATGGATGGATCCATTCTCTCTAGTGAAGTTTGATGAAACGCATGAAAATTTCCTTACTTGTGTCTCTGTTCTTTAAGGATAAAGCGACAACGTTGCC[G/A]
CAACAGGAATTGCAACGGTTAACTGCTACATTATTTTTTAACGCATCTGCCTGTAAACACTATATAAATAATATATTTTTTGGCTTCCTAAAGGAAGTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 30.90% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 15.70% | 83.90% | 0.46% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.60% | 97.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 35.90% | 63.30% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.90% | 84.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 47.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1023155972 | C -> T | LOC_Os10g42950.1 | upstream_gene_variant ; 2712.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42960.1 | upstream_gene_variant ; 910.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42950.3 | upstream_gene_variant ; 2750.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42950.2 | upstream_gene_variant ; 2712.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42950.4 | upstream_gene_variant ; 2712.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42950.5 | upstream_gene_variant ; 2712.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42970.1 | downstream_gene_variant ; 4494.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42970.2 | downstream_gene_variant ; 4449.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1023155972 | C -> T | LOC_Os10g42950-LOC_Os10g42960 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1023155972 | NA | 1.12E-06 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023155972 | 7.11E-07 | 7.11E-07 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023155972 | NA | 7.98E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023155972 | 2.29E-06 | 2.29E-06 | mr1264_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023155972 | NA | 8.19E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1023155972 | NA | 2.29E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |