\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022753746:

Variant ID: vg1022753746 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22753746
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAATTCAGATTTGGTGTTCTGTTGTGCAGTTGGGTTAGGGTGCGTTAACGTCAAAATTGAAAGTTTGTTTGAAATTGAAACGATGTAACAGATAAATT[A/G]
AAAATTTATGTGTGTAGGAAAGTTTTAATATGATAAAAAAATTGAAAGTTTTAAAAGAAAGTTTGGAACAAAACTCGACCTTACTATTTCATTCTAAATG

Reverse complement sequence

CATTTAGAATGAAATAGTAAGGTCGAGTTTTGTTCCAAACTTTCTTTTAAAACTTTCAATTTTTTTATCATATTAAAACTTTCCTACACACATAAATTTT[T/C]
AATTTATCTGTTACATCGTTTCAATTTCAAACAAACTTTCAATTTTGACGTTAACGCACCCTAACCCAACTGCACAACAGAACACCAAATCTGAATTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 41.20% 0.30% 0.00% NA
All Indica  2759 69.70% 30.10% 0.22% 0.00% NA
All Japonica  1512 33.90% 65.80% 0.26% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 66.20% 33.40% 0.34% 0.00% NA
Indica II  465 90.80% 9.00% 0.22% 0.00% NA
Indica III  913 53.00% 47.00% 0.00% 0.00% NA
Indica Intermediate  786 79.10% 20.50% 0.38% 0.00% NA
Temperate Japonica  767 37.40% 62.30% 0.26% 0.00% NA
Tropical Japonica  504 17.90% 82.10% 0.00% 0.00% NA
Japonica Intermediate  241 56.40% 42.70% 0.83% 0.00% NA
VI/Aromatic  96 17.70% 80.20% 2.08% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022753746 A -> G LOC_Os10g42250.1 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022753746 A -> G LOC_Os10g42250.2 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022753746 A -> G LOC_Os10g42240.1 downstream_gene_variant ; 641.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022753746 A -> G LOC_Os10g42260.1 downstream_gene_variant ; 3564.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022753746 A -> G LOC_Os10g42240.2 downstream_gene_variant ; 641.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022753746 A -> G LOC_Os10g42240-LOC_Os10g42250 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1022753746 A G -0.04 0.0 -0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022753746 5.74E-06 1.46E-06 mr1060_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022753746 NA 5.98E-07 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251