Search for Variation information by Variation ID:
Detailed information for vg1021514488:
| Variant ID: vg1021514488 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 21514488 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GCTAAATGTGATGACCACTAAGACAAGTTGGATACCTCCTTTACAACATAAATAACCTAATCAAGAGGTCACTAAGAGGTGAAAAGGCTACTCACTTGAG[G/A]
TGGCCGTTGCCATCCCGGCCTTCGCATCAAGAGTTTGATCCACATTGTCAGACGAAACATGTGGTTCAAAATCGAGTACCGGAATCATCGCCAGTGACTC
Reverse complement sequence
GAGTCACTGGCGATGATTCCGGTACTCGATTTTGAACCACATGTTTCGTCTGACAATGTGGATCAAACTCTTGATGCGAAGGCCGGGATGGCAACGGCCA[C/T]
CTCAAGTGAGTAGCCTTTTCACCTCTTAGTGACCTCTTGATTAGGTTATTTATGTTGTAAAGGAGGTATCCAACTTGTCTTAGTGGTCATCACATTTAGC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 39.30% | 2.43% | 0.00% | NA |
| All Indica | 2759 | 90.50% | 6.30% | 3.15% | 0.00% | NA |
| All Japonica | 1512 | 1.20% | 98.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 67.70% | 22.30% | 10.04% | 0.00% | NA |
| Indica I | 595 | 87.40% | 6.70% | 5.88% | 0.00% | NA |
| Indica II | 465 | 90.10% | 7.30% | 2.58% | 0.00% | NA |
| Indica III | 913 | 93.40% | 4.30% | 2.30% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 7.90% | 2.42% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1021514488 | G -> A | LOC_Os10g40190.1 | missense_variant ; p.Thr575Ile; MODERATE | nonsynonymous_codon ; T575I | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | possibly damaging  |
1.546 |
TOLERATED | 0.10 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1021514488 | NA | 6.91E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021514488 | NA | 1.27E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021514488 | NA | 8.53E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021514488 | NA | 3.02E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021514488 | 5.63E-06 | NA | mr1682 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021514488 | NA | 6.27E-22 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021514488 | NA | 7.66E-15 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021514488 | NA | 3.75E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |