Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1020927774:

Variant ID: vg1020927774 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20927774
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGTCTGATAATGTTGAGCCGCAATTAAAAACAGTCTTTAGTATTGGTTAGTACTCTATTACTTTTTAAATATTTGACGCCCTTAACTTTTTTTAAATAT[A/G]
TTTGACTGTTCATCTTATTAAAAAATTTTAAATAATTATTAATTCTTTTTCTATCGTTTGATTCATTGTTAAATATACTTAGAGTAAAGTGTACGGGCAG

Reverse complement sequence

CTGCCCGTACACTTTACTCTAAGTATATTTAACAATGAATCAAACGATAGAAAAAGAATTAATAATTATTTAAAATTTTTTAATAAGATGAACAGTCAAA[T/C]
ATATTTAAAAAAAGTTAAGGGCGTCAAATATTTAAAAAGTAATAGAGTACTAACCAATACTAAAGACTGTTTTTAATTGCGGCTCAACATTATCAGACCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.10%	0.23%	0.00%	NA
All Indica	2759	97.80%	2.10%	0.04%	0.00%	NA
All Japonica	1512	93.50%	6.30%	0.20%	0.00%	NA
Aus	269	54.60%	44.20%	1.12%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	95.50%	4.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.80%	0.13%	0.00%	NA
Temperate Japonica	767	92.60%	7.20%	0.26%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	83.00%	16.60%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	7.30%	1.04%	0.00%	NA
Intermediate	90	90.00%	6.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020927774	A -> G	LOC_Os10g39200.1	downstream_gene_variant ; 1842.0bp to feature; MODIFIER	silent_mutation	Average:72.105; most accessible tissue: Minghui63 panicle, score: 95.915	N	N	N	N
vg1020927774	A -> G	LOC_Os10g39200.2	downstream_gene_variant ; 1844.0bp to feature; MODIFIER	silent_mutation	Average:72.105; most accessible tissue: Minghui63 panicle, score: 95.915	N	N	N	N
vg1020927774	A -> G	LOC_Os10g39200.3	downstream_gene_variant ; 1844.0bp to feature; MODIFIER	silent_mutation	Average:72.105; most accessible tissue: Minghui63 panicle, score: 95.915	N	N	N	N
vg1020927774	A -> G	LOC_Os10g39200.4	downstream_gene_variant ; 1844.0bp to feature; MODIFIER	silent_mutation	Average:72.105; most accessible tissue: Minghui63 panicle, score: 95.915	N	N	N	N
vg1020927774	A -> G	LOC_Os10g39190-LOC_Os10g39200	intergenic_region ; MODIFIER	silent_mutation	Average:72.105; most accessible tissue: Minghui63 panicle, score: 95.915	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1020927774	A	G	-0.01	-0.02	-0.01	-0.03	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020927774	NA	2.98E-06	Grain_weight	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020927774	NA	7.60E-09	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020927774	NA	6.79E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020927774	NA	8.08E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251