\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020881804:

Variant ID: vg1020881804 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20881804
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGATGGTTGTCGTCGTAATCGTATGATTATTGTGTAAAATTTAATGTTCACGTTGGTGTAGTGGGTATCGATATCTAACGGGTACCCATTACGCGCAC[G/A]
GGTGTAGCTACCGTGAGAATCTCGCACGGATGCGGGAACTTTTAATCATCACGGGTATGGGTATAGTGTAACAAAACTCGATAGGTGTGCAACCGTTGCC

Reverse complement sequence

GGCAACGGTTGCACACCTATCGAGTTTTGTTACACTATACCCATACCCGTGATGATTAAAAGTTCCCGCATCCGTGCGAGATTCTCACGGTAGCTACACC[C/T]
GTGCGCGTAATGGGTACCCGTTAGATATCGATACCCACTACACCAACGTGAACATTAAATTTTACACAATAATCATACGATTACGACGACAACCATCAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.20% 0.19% 0.00% NA
All Indica  2759 91.00% 8.80% 0.22% 0.00% NA
All Japonica  1512 2.10% 97.80% 0.13% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 97.60% 2.20% 0.17% 0.00% NA
Indica II  465 71.40% 28.60% 0.00% 0.00% NA
Indica III  913 98.10% 1.80% 0.11% 0.00% NA
Indica Intermediate  786 89.30% 10.20% 0.51% 0.00% NA
Temperate Japonica  767 1.60% 98.20% 0.26% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020881804 G -> A LOC_Os10g39140.1 upstream_gene_variant ; 4548.0bp to feature; MODIFIER silent_mutation Average:76.709; most accessible tissue: Minghui63 young leaf, score: 99.329 N N N N
vg1020881804 G -> A LOC_Os10g39140.2 upstream_gene_variant ; 4548.0bp to feature; MODIFIER silent_mutation Average:76.709; most accessible tissue: Minghui63 young leaf, score: 99.329 N N N N
vg1020881804 G -> A LOC_Os10g39140.3 upstream_gene_variant ; 4548.0bp to feature; MODIFIER silent_mutation Average:76.709; most accessible tissue: Minghui63 young leaf, score: 99.329 N N N N
vg1020881804 G -> A LOC_Os10g39140.4 upstream_gene_variant ; 4548.0bp to feature; MODIFIER silent_mutation Average:76.709; most accessible tissue: Minghui63 young leaf, score: 99.329 N N N N
vg1020881804 G -> A LOC_Os10g39130-LOC_Os10g39140 intergenic_region ; MODIFIER silent_mutation Average:76.709; most accessible tissue: Minghui63 young leaf, score: 99.329 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1020881804 G A 0.0 -0.03 0.01 -0.03 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020881804 NA 2.30E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 6.71E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 6.80E-08 mr1343 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 8.51E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 6.85E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 6.45E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 8.75E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 1.97E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 1.74E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 5.80E-36 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 2.54E-09 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 3.66E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 3.11E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 3.74E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 6.71E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 8.87E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 3.18E-13 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 3.63E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 7.49E-33 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020881804 NA 2.34E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251