\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020742753:

Variant ID: vg1020742753 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20742753
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACGAGTGATCTGCAAGTTTAGGGAACGGGATGACACAGTCGAACAAGTTTGAGTACCTAAACGGTCGATTTGCGAGTTTAGAGACCAGATGACACAGCG[A/G]
TATAAGTTTAGGGACCGGTGATGAACTTTCCTCTTCCATTTATACACGTCGATTCCTTCCGTTTGCTCTTCAGTCGATCAACGGAAGAGGAAAAAAAAAT

Reverse complement sequence

ATTTTTTTTTCCTCTTCCGTTGATCGACTGAAGAGCAAACGGAAGGAATCGACGTGTATAAATGGAAGAGGAAAGTTCATCACCGGTCCCTAAACTTATA[T/C]
CGCTGTGTCATCTGGTCTCTAAACTCGCAAATCGACCGTTTAGGTACTCAAACTTGTTCGACTGTGTCATCCCGTTCCCTAAACTTGCAGATCACTCGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 35.20% 0.11% 0.00% NA
All Indica  2759 98.50% 1.40% 0.14% 0.00% NA
All Japonica  1512 4.00% 96.00% 0.00% 0.00% NA
Aus  269 55.80% 44.20% 0.00% 0.00% NA
Indica I  595 98.00% 1.70% 0.34% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 97.30% 2.50% 0.13% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 6.00% 94.00% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020742753 A -> G LOC_Os10g38940.1 upstream_gene_variant ; 1668.0bp to feature; MODIFIER silent_mutation Average:46.957; most accessible tissue: Callus, score: 80.825 N N N N
vg1020742753 A -> G LOC_Os10g38930.1 downstream_gene_variant ; 4440.0bp to feature; MODIFIER silent_mutation Average:46.957; most accessible tissue: Callus, score: 80.825 N N N N
vg1020742753 A -> G LOC_Os10g38930-LOC_Os10g38940 intergenic_region ; MODIFIER silent_mutation Average:46.957; most accessible tissue: Callus, score: 80.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020742753 NA 2.36E-21 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 2.41E-22 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 5.27E-46 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 4.21E-09 8.60E-63 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 1.27E-06 3.40E-07 mr1558 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 1.22E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 5.90E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 4.08E-31 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 2.46E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 6.05E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 6.40E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 7.05E-06 3.35E-51 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 2.07E-09 1.19E-76 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 1.32E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 1.97E-17 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 3.91E-20 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 2.89E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 8.91E-19 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 5.55E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 3.17E-34 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742753 NA 7.97E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251