Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020529341:

Variant ID: vg1020529341 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20529341
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCACGTGTCTCAGTTGAAGAAATGTCTTCGTGTTCCAGAAGAACAAGTTCCCCTAGGCAATATCGAGCTGGAAAAGAATCTGACCTACAAAGAAAGGCCG[A/G]
TCAGAGTTCTTGAAAAGGCAGAACGTCAGACTCGACGAAAGACCATCAAGTTCTACAAGGTCCAATGGAGCAACCATTCCGAAGATGAAGCAACCTGGGA

Reverse complement sequence

TCCCAGGTTGCTTCATCTTCGGAATGGTTGCTCCATTGGACCTTGTAGAACTTGATGGTCTTTCGTCGAGTCTGACGTTCTGCCTTTTCAAGAACTCTGA[T/C]
CGGCCTTTCTTTGTAGGTCAGATTCTTTTCCAGCTCGATATTGCCTAGGGGAACTTGTTCTTCTGGAACACGAAGACATTTCTTCAACTGAGACACGTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.10%	9.60%	1.27%	60.96%	NA
All Indica	2759	8.20%	0.30%	2.07%	89.49%	NA
All Japonica	1512	62.50%	29.20%	0.00%	8.33%	NA
Aus	269	44.20%	0.00%	0.74%	55.02%	NA
Indica I	595	15.50%	0.20%	2.35%	82.02%	NA
Indica II	465	4.30%	0.90%	0.43%	94.41%	NA
Indica III	913	4.90%	0.10%	2.52%	92.44%	NA
Indica Intermediate	786	8.80%	0.10%	2.29%	88.80%	NA
Temperate Japonica	767	86.60%	11.20%	0.00%	2.22%	NA
Tropical Japonica	504	21.80%	59.30%	0.00%	18.85%	NA
Japonica Intermediate	241	71.00%	23.20%	0.00%	5.81%	NA
VI/Aromatic	96	10.40%	0.00%	0.00%	89.58%	NA
Intermediate	90	33.30%	7.80%	1.11%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020529341	A -> G	LOC_Os10g38420.1	missense_variant ; p.Ile188Val; MODERATE	nonsynonymous_codon ; I188V	Average:9.938; most accessible tissue: Minghui63 young leaf, score: 23.613	benign	-0.142	TOLERATED	1.00
vg1020529341	A -> DEL	LOC_Os10g38420.1	N	frameshift_variant	Average:9.938; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020529341	NA	7.77E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	9.16E-06	NA	mr1267_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	8.07E-08	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	8.05E-06	3.50E-07	mr1284_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	6.01E-06	6.00E-06	mr1286_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	6.87E-07	1.63E-06	mr1312_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	3.12E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	1.99E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	3.77E-07	1.52E-08	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	5.75E-08	2.34E-10	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	1.50E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	2.52E-06	5.83E-09	mr1524_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	7.26E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	7.91E-07	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	1.35E-06	NA	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	4.64E-07	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	4.32E-07	4.32E-07	mr1674_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	9.95E-06	7.12E-10	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	2.79E-07	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	1.48E-06	1.48E-06	mr1688_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	1.34E-06	1.33E-06	mr1766_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	5.95E-08	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	3.34E-06	3.13E-07	mr1832_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	2.50E-06	1.97E-07	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	4.83E-07	6.59E-08	mr1843_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	5.78E-07	5.79E-07	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341	NA	3.32E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251