\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020529341:

Variant ID: vg1020529341 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20529341
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACGTGTCTCAGTTGAAGAAATGTCTTCGTGTTCCAGAAGAACAAGTTCCCCTAGGCAATATCGAGCTGGAAAAGAATCTGACCTACAAAGAAAGGCCG[A/G]
TCAGAGTTCTTGAAAAGGCAGAACGTCAGACTCGACGAAAGACCATCAAGTTCTACAAGGTCCAATGGAGCAACCATTCCGAAGATGAAGCAACCTGGGA

Reverse complement sequence

TCCCAGGTTGCTTCATCTTCGGAATGGTTGCTCCATTGGACCTTGTAGAACTTGATGGTCTTTCGTCGAGTCTGACGTTCTGCCTTTTCAAGAACTCTGA[T/C]
CGGCCTTTCTTTGTAGGTCAGATTCTTTTCCAGCTCGATATTGCCTAGGGGAACTTGTTCTTCTGGAACACGAAGACATTTCTTCAACTGAGACACGTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.10% 9.60% 1.27% 60.96% NA
All Indica  2759 8.20% 0.30% 2.07% 89.49% NA
All Japonica  1512 62.50% 29.20% 0.00% 8.33% NA
Aus  269 44.20% 0.00% 0.74% 55.02% NA
Indica I  595 15.50% 0.20% 2.35% 82.02% NA
Indica II  465 4.30% 0.90% 0.43% 94.41% NA
Indica III  913 4.90% 0.10% 2.52% 92.44% NA
Indica Intermediate  786 8.80% 0.10% 2.29% 88.80% NA
Temperate Japonica  767 86.60% 11.20% 0.00% 2.22% NA
Tropical Japonica  504 21.80% 59.30% 0.00% 18.85% NA
Japonica Intermediate  241 71.00% 23.20% 0.00% 5.81% NA
VI/Aromatic  96 10.40% 0.00% 0.00% 89.58% NA
Intermediate  90 33.30% 7.80% 1.11% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020529341 A -> G LOC_Os10g38420.1 missense_variant ; p.Ile188Val; MODERATE nonsynonymous_codon ; I188V Average:9.938; most accessible tissue: Minghui63 young leaf, score: 23.613 benign -0.142 TOLERATED 1.00
vg1020529341 A -> DEL LOC_Os10g38420.1 N frameshift_variant Average:9.938; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020529341 NA 7.77E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 9.16E-06 NA mr1267_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 8.07E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 8.05E-06 3.50E-07 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 6.01E-06 6.00E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 6.87E-07 1.63E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 3.12E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 1.99E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 3.77E-07 1.52E-08 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 5.75E-08 2.34E-10 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 1.50E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 2.52E-06 5.83E-09 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 7.26E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 7.91E-07 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 1.35E-06 NA mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 4.64E-07 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 4.32E-07 4.32E-07 mr1674_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 9.95E-06 7.12E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 2.79E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 1.48E-06 1.48E-06 mr1688_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 1.34E-06 1.33E-06 mr1766_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 5.95E-08 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 3.34E-06 3.13E-07 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 2.50E-06 1.97E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 4.83E-07 6.59E-08 mr1843_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 5.78E-07 5.79E-07 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020529341 NA 3.32E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251