| Variant ID: vg1020503245 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20503245 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTCGGGACGTGACAAAAGATGGTATCAGAGCACAGGCTTGGCCCTAGGGCGAAACCCGACGTTTAGGACGACCCTAAGGATACTAAGTTCTACTTGCGAA[A/G]
AGCTAAGGCTTCCTTTTTTGCTTTCTTTATTTTCAATAGTTTATTGCTAAAATGGTTACTTATCTTTCCTCTCCCTTTCAAAATTGTAGATGGCAGTGAA
TTCACTGCCATCTACAATTTTGAAAGGGAGAGGAAAGATAAGTAACCATTTTAGCAATAAACTATTGAAAATAAAGAAAGCAAAAAAGGAAGCCTTAGCT[T/C]
TTCGCAAGTAGAACTTAGTATCCTTAGGGTCGTCCTAAACGTCGGGTTTCGCCCTAGGGCCAAGCCTGTGCTCTGATACCATCTTTTGTCACGTCCCGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.60% | 2.30% | 18.96% | 47.12% | NA |
| All Indica | 2759 | 3.00% | 0.10% | 24.32% | 72.56% | NA |
| All Japonica | 1512 | 83.90% | 6.10% | 2.05% | 8.00% | NA |
| Aus | 269 | 43.90% | 0.00% | 51.30% | 4.83% | NA |
| Indica I | 595 | 3.90% | 0.00% | 24.20% | 71.93% | NA |
| Indica II | 465 | 2.20% | 0.00% | 24.95% | 72.90% | NA |
| Indica III | 913 | 1.20% | 0.30% | 24.64% | 73.82% | NA |
| Indica Intermediate | 786 | 4.80% | 0.10% | 23.66% | 71.37% | NA |
| Temperate Japonica | 767 | 93.60% | 2.60% | 1.69% | 2.09% | NA |
| Tropical Japonica | 504 | 68.30% | 10.50% | 2.98% | 18.25% | NA |
| Japonica Intermediate | 241 | 85.50% | 7.90% | 1.24% | 5.39% | NA |
| VI/Aromatic | 96 | 2.10% | 4.20% | 39.58% | 54.17% | NA |
| Intermediate | 90 | 27.80% | 8.90% | 20.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020503245 | A -> G | LOC_Os10g38360.1 | downstream_gene_variant ; 4148.0bp to feature; MODIFIER | silent_mutation | Average:6.353; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg1020503245 | A -> G | LOC_Os10g38370.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.353; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| vg1020503245 | A -> DEL | N | N | silent_mutation | Average:6.353; most accessible tissue: Zhenshan97 root, score: 10.511 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020503245 | NA | 2.71E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020503245 | NA | 3.02E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020503245 | 3.14E-06 | 3.14E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020503245 | NA | 1.97E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020503245 | 6.79E-06 | 6.79E-06 | mr1166_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020503245 | NA | 2.59E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020503245 | 4.16E-06 | 1.77E-07 | mr1765_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |