Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1020493966:

Variant ID: vg1020493966 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20493966
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACGGAGGAGGAGAAGGTGGAGGGGAGGAAGCAGACGTTCGCGGTGGCGGAGACGCTGGAGGGAGCCCTGAGGGAGTGCTCCAAGGGGAAGCCCTTCTT[T/C]
GGCGGCGACGCCGTCGGGTACGTCGACGTCGCGCTCGGTGGCTTCGTCCCGTGGGTGCATGCGATGGAGGAGCTGTTCGGGTTGAAGCAGTTCGACGCCG

Reverse complement sequence

CGGCGTCGAACTGCTTCAACCCGAACAGCTCCTCCATCGCATGCACCCACGGGACGAAGCCACCGAGCGCGACGTCGACGTACCCGACGGCGTCGCCGCC[A/G]
AAGAAGGGCTTCCCCTTGGAGCACTCCCTCAGGGCTCCCTCCAGCGTCTCCGCCACCGCGAACGTCTGCTTCCTCCCCTCCACCTTCTCCTCCTCCGTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	24.80%	0.63%	0.00%	NA
All Indica	2759	96.10%	2.90%	1.01%	0.00%	NA
All Japonica	1512	37.40%	62.50%	0.07%	0.00%	NA
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	91.30%	6.90%	1.85%	0.00%	NA
Indica II	465	97.60%	1.50%	0.86%	0.00%	NA
Indica III	913	99.20%	0.50%	0.22%	0.00%	NA
Indica Intermediate	786	95.20%	3.40%	1.40%	0.00%	NA
Temperate Japonica	767	13.40%	86.60%	0.00%	0.00%	NA
Tropical Japonica	504	78.00%	21.80%	0.20%	0.00%	NA
Japonica Intermediate	241	29.00%	71.00%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020493966	T -> C	LOC_Os10g38350.1	synonymous_variant ; p.Phe154Phe; LOW	synonymous_codon	Average:63.507; most accessible tissue: Zhenshan97 root, score: 89.905	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1020493966	T	C	0.05	0.04	0.06	0.03	0.04	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020493966	2.05E-06	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020493966	2.34E-07	NA	mr1071	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	9.92E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	3.64E-06	NA	mr1100	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	4.74E-08	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	7.03E-06	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	7.16E-06	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	9.34E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	2.34E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	1.17E-09	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	1.66E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	2.01E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	2.43E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	8.41E-06	NA	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	1.94E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	3.38E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493966	NA	4.64E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251