Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020492622:

Variant ID: vg1020492622 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20492622
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGTTACGCTAGGTGTTTTGGTTGAGGAGAGAGGGCGCTCATATTTGAGTTCCGCCTCGGTTGGCACCCAAAGTAGGTCCTTAGTATGGGTACTCTGTT[G/A]
GACCCTGTTTTTTTCCGCTACAGTAGCCTGGAGCACGCATTTTGGGTTTGGTTGTCGCTATGCCTAGGCTGTTGGAGATAGTCTAACGACTGCGTTTATG

Reverse complement sequence

CATAAACGCAGTCGTTAGACTATCTCCAACAGCCTAGGCATAGCGACAACCAAACCCAAAATGCGTGCTCCAGGCTACTGTAGCGGAAAAAAACAGGGTC[C/T]
AACAGAGTACCCATACTAAGGACCTACTTTGGGTGCCAACCGAGGCGGAACTCAAATATGAGCGCCCTCTCTCCTCAACCAAAACACCTAGCGTAACTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.90%	0.10%	0.59%	63.37%	NA
All Indica	2759	5.80%	0.00%	0.72%	93.44%	NA
All Japonica	1512	90.80%	0.50%	0.40%	8.33%	NA
Aus	269	42.80%	0.00%	0.00%	57.25%	NA
Indica I	595	12.30%	0.00%	1.18%	86.55%	NA
Indica II	465	4.30%	0.00%	0.86%	94.84%	NA
Indica III	913	1.00%	0.00%	0.22%	98.80%	NA
Indica Intermediate	786	7.50%	0.00%	0.89%	91.60%	NA
Temperate Japonica	767	96.20%	0.90%	0.65%	2.22%	NA
Tropical Japonica	504	81.00%	0.00%	0.20%	18.85%	NA
Japonica Intermediate	241	94.20%	0.00%	0.00%	5.81%	NA
VI/Aromatic	96	9.40%	0.00%	2.08%	88.54%	NA
Intermediate	90	42.20%	0.00%	0.00%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020492622	G -> A	LOC_Os10g38350.1	upstream_gene_variant ; 710.0bp to feature; MODIFIER	silent_mutation	Average:36.198; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg1020492622	G -> A	LOC_Os10g38340.1	downstream_gene_variant ; 2728.0bp to feature; MODIFIER	silent_mutation	Average:36.198; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg1020492622	G -> A	LOC_Os10g38340-LOC_Os10g38350	intergenic_region ; MODIFIER	silent_mutation	Average:36.198; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg1020492622	G -> DEL	N	N	silent_mutation	Average:36.198; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020492622	4.75E-06	NA	mr1305	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	3.17E-07	1.55E-47	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	4.02E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	6.98E-11	3.12E-62	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	7.42E-06	3.27E-08	mr1558	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	5.11E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	4.29E-06	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	8.35E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	1.38E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	3.18E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	1.83E-07	1.46E-52	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	9.05E-08	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	7.28E-13	1.04E-82	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	5.77E-06	4.14E-12	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	1.15E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	1.35E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	8.75E-19	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	2.51E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020492622	NA	2.36E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251