Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1019119286:

Variant ID: vg1019119286 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19119286
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CTCATATGTCAACCAGGTTTCCTTCAATATACTCTCTCACTAACTTAGGGCCAGTTCACTTTGATGACATTTTCAACCATACTATTTTTTTTAAAGTAGC[C/T,A]
AAAAAAATGTCTACGTTTAGTTTGTTGTCAAATTTAATCAATACAAAAGAAATCATATTAAAATTTTGGTAATATTGCCATCTTGCCAAATTTTTGGCAT

Reverse complement sequence

ATGCCAAAAATTTGGCAAGATGGCAATATTACCAAAATTTTAATATGATTTCTTTTGTATTGATTAAATTTGACAACAAACTAAACGTAGACATTTTTTT[G/A,T]
GCTACTTTAAAAAAAATAGTATGGTTGAAAATGTCATCAAAGTGAACTGGCCCTAAGTTAGTGAGAGAGTATATTGAAGGAAACCTGGTTGACATATGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.30%	17.00%	1.67%	0.00%	A: 0.11%
All Indica	2759	85.10%	13.50%	1.30%	0.00%	A: 0.07%
All Japonica	1512	89.00%	8.50%	2.45%	0.00%	A: 0.07%
Aus	269	19.30%	79.20%	1.12%	0.00%	A: 0.37%
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	54.00%	45.20%	0.86%	0.00%	NA
Indica III	913	96.50%	2.10%	1.31%	0.00%	A: 0.11%
Indica Intermediate	786	79.40%	17.90%	2.54%	0.00%	A: 0.13%
Temperate Japonica	767	94.30%	3.80%	1.96%	0.00%	NA
Tropical Japonica	504	92.10%	6.50%	1.39%	0.00%	NA
Japonica Intermediate	241	66.00%	27.40%	6.22%	0.00%	A: 0.41%
VI/Aromatic	96	33.30%	64.60%	1.04%	0.00%	A: 1.04%
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019119286	C -> T	LOC_Os10g35760.1	downstream_gene_variant ; 4997.0bp to feature; MODIFIER	silent_mutation	Average:48.272; most accessible tissue: Callus, score: 80.979	N	N	N	N
vg1019119286	C -> T	LOC_Os10g35760.2	downstream_gene_variant ; 1661.0bp to feature; MODIFIER	silent_mutation	Average:48.272; most accessible tissue: Callus, score: 80.979	N	N	N	N
vg1019119286	C -> T	LOC_Os10g35760-LOC_Os10g35770	intergenic_region ; MODIFIER	silent_mutation	Average:48.272; most accessible tissue: Callus, score: 80.979	N	N	N	N
vg1019119286	C -> A	LOC_Os10g35760.1	downstream_gene_variant ; 4997.0bp to feature; MODIFIER	silent_mutation	Average:48.272; most accessible tissue: Callus, score: 80.979	N	N	N	N
vg1019119286	C -> A	LOC_Os10g35760.2	downstream_gene_variant ; 1661.0bp to feature; MODIFIER	silent_mutation	Average:48.272; most accessible tissue: Callus, score: 80.979	N	N	N	N
vg1019119286	C -> A	LOC_Os10g35760-LOC_Os10g35770	intergenic_region ; MODIFIER	silent_mutation	Average:48.272; most accessible tissue: Callus, score: 80.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019119286	NA	3.90E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	5.20E-08	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	9.29E-07	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.05E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.87E-08	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	7.93E-08	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.04E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	8.12E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.14E-08	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.88E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	4.28E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	3.18E-07	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.62E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.53E-07	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.61E-09	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	3.45E-08	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.45E-08	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.31E-08	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.01E-09	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	4.63E-09	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.41E-08	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	3.93E-07	3.93E-07	mr1197_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.95E-08	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	1.22E-07	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	4.76E-08	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.73E-08	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.50E-10	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	5.97E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019119286	NA	2.13E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251