\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019004923:

Variant ID: vg1019004923 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19004923
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAACACTCCCGATAATCTGGGTGATTTTAGTGCCACATTTTCCAGAATTTGGGTTATCCCAGGATCCGATCCTATATCCCTAATTAACACTCCCGGC[G/A]
ATTCTACCCAACTAGGATTAAAAAAACGCGAATATTAGGGAAGGACCTAATATCAAATAATTAGAAGGGGTGAGGCTTCGAACCCAGGTCGTCTATTCCA

Reverse complement sequence

TGGAATAGACGACCTGGGTTCGAAGCCTCACCCCTTCTAATTATTTGATATTAGGTCCTTCCCTAATATTCGCGTTTTTTTAATCCTAGTTGGGTAGAAT[C/T]
GCCGGGAGTGTTAATTAGGGATATAGGATCGGATCCTGGGATAACCCAAATTCTGGAAAATGTGGCACTAAAATCACCCAGATTATCGGGAGTGTTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 0.10% 16.23% 48.62% NA
All Indica  2759 16.20% 0.10% 11.60% 72.02% NA
All Japonica  1512 76.20% 0.10% 10.71% 13.03% NA
Aus  269 4.80% 0.00% 76.95% 18.22% NA
Indica I  595 4.00% 0.20% 7.23% 88.57% NA
Indica II  465 52.70% 0.00% 3.23% 44.09% NA
Indica III  913 2.70% 0.00% 14.13% 83.13% NA
Indica Intermediate  786 19.60% 0.40% 16.92% 63.10% NA
Temperate Japonica  767 96.60% 0.00% 1.43% 1.96% NA
Tropical Japonica  504 41.30% 0.00% 25.60% 33.13% NA
Japonica Intermediate  241 84.20% 0.40% 9.13% 6.22% NA
VI/Aromatic  96 3.10% 0.00% 66.67% 30.21% NA
Intermediate  90 44.40% 0.00% 15.56% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019004923 G -> A LOC_Os10g35540.1 upstream_gene_variant ; 899.0bp to feature; MODIFIER silent_mutation Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1019004923 G -> A LOC_Os10g35520.1 downstream_gene_variant ; 3886.0bp to feature; MODIFIER silent_mutation Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1019004923 G -> A LOC_Os10g35530.1 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1019004923 G -> A LOC_Os10g35550.1 downstream_gene_variant ; 4757.0bp to feature; MODIFIER silent_mutation Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1019004923 G -> A LOC_Os10g35530.2 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1019004923 G -> A LOC_Os10g35530-LOC_Os10g35540 intergenic_region ; MODIFIER silent_mutation Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1019004923 G -> DEL N N silent_mutation Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019004923 NA 7.17E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 5.95E-14 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 1.21E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 3.58E-06 NA mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 9.73E-06 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 5.32E-15 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 1.87E-12 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 2.80E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 4.26E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 4.34E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 1.36E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 5.11E-19 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 4.58E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 5.83E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 3.33E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 1.45E-18 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 2.91E-06 NA mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 6.02E-06 1.00E-14 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 5.42E-06 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 2.86E-07 7.70E-17 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 NA 2.22E-13 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 5.82E-07 NA mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923 2.77E-07 2.39E-15 mr1862_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251