Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019004923:

Variant ID: vg1019004923 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19004923
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TATTAACACTCCCGATAATCTGGGTGATTTTAGTGCCACATTTTCCAGAATTTGGGTTATCCCAGGATCCGATCCTATATCCCTAATTAACACTCCCGGC[G/A]
ATTCTACCCAACTAGGATTAAAAAAACGCGAATATTAGGGAAGGACCTAATATCAAATAATTAGAAGGGGTGAGGCTTCGAACCCAGGTCGTCTATTCCA

Reverse complement sequence

TGGAATAGACGACCTGGGTTCGAAGCCTCACCCCTTCTAATTATTTGATATTAGGTCCTTCCCTAATATTCGCGTTTTTTTAATCCTAGTTGGGTAGAAT[C/T]
GCCGGGAGTGTTAATTAGGGATATAGGATCGGATCCTGGGATAACCCAAATTCTGGAAAATGTGGCACTAAAATCACCCAGATTATCGGGAGTGTTAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	0.10%	16.23%	48.62%	NA
All Indica	2759	16.20%	0.10%	11.60%	72.02%	NA
All Japonica	1512	76.20%	0.10%	10.71%	13.03%	NA
Aus	269	4.80%	0.00%	76.95%	18.22%	NA
Indica I	595	4.00%	0.20%	7.23%	88.57%	NA
Indica II	465	52.70%	0.00%	3.23%	44.09%	NA
Indica III	913	2.70%	0.00%	14.13%	83.13%	NA
Indica Intermediate	786	19.60%	0.40%	16.92%	63.10%	NA
Temperate Japonica	767	96.60%	0.00%	1.43%	1.96%	NA
Tropical Japonica	504	41.30%	0.00%	25.60%	33.13%	NA
Japonica Intermediate	241	84.20%	0.40%	9.13%	6.22%	NA
VI/Aromatic	96	3.10%	0.00%	66.67%	30.21%	NA
Intermediate	90	44.40%	0.00%	15.56%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019004923	G -> A	LOC_Os10g35540.1	upstream_gene_variant ; 899.0bp to feature; MODIFIER	silent_mutation	Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1019004923	G -> A	LOC_Os10g35520.1	downstream_gene_variant ; 3886.0bp to feature; MODIFIER	silent_mutation	Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1019004923	G -> A	LOC_Os10g35530.1	downstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1019004923	G -> A	LOC_Os10g35550.1	downstream_gene_variant ; 4757.0bp to feature; MODIFIER	silent_mutation	Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1019004923	G -> A	LOC_Os10g35530.2	downstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1019004923	G -> A	LOC_Os10g35530-LOC_Os10g35540	intergenic_region ; MODIFIER	silent_mutation	Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1019004923	G -> DEL	N	N	silent_mutation	Average:19.242; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019004923	NA	7.17E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	5.95E-14	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	1.21E-15	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	3.58E-06	NA	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	9.73E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	5.32E-15	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	1.87E-12	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	2.80E-09	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	4.26E-06	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	4.34E-08	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	1.36E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	5.11E-19	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	4.58E-18	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	5.83E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	3.33E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	1.45E-18	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	2.91E-06	NA	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	6.02E-06	1.00E-14	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	5.42E-06	NA	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	2.86E-07	7.70E-17	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	NA	2.22E-13	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	5.82E-07	NA	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019004923	2.77E-07	2.39E-15	mr1862_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251