Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1018873646:

Variant ID: vg1018873646 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18873646
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACACAAATTTAACTACAGTAGGTCAACATATACCCACGAGTTAATAACCTGAATCCAAACTACACTAGTACAGTCATAGGCTCTTGTTACGCTAATTTAG[T/A]
ATGCGCATACGACATACGTATATACTTTCATAGCGCATGTGTATGCATGTATGCATACATAGGCTATACATGCATATACACACACATATATATACGTATA

Reverse complement sequence

TATACGTATATATATGTGTGTGTATATGCATGTATAGCCTATGTATGCATACATGCATACACATGCGCTATGAAAGTATATACGTATGTCGTATGCGCAT[A/T]
CTAAATTAGCGTAACAAGAGCCTATGACTGTACTAGTGTAGTTTGGATTCAGGTTATTAACTCGTGGGTATATGTTGACCTACTGTAGTTAAATTTGTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 45.20% 0.02% 0.00% NA
All Indica  2759 76.50% 23.50% 0.04% 0.00% NA
All Japonica  1512 21.80% 78.20% 0.00% 0.00% NA
Aus  269 37.90% 62.10% 0.00% 0.00% NA
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 43.70% 56.30% 0.00% 0.00% NA
Indica III  913 86.10% 13.90% 0.00% 0.00% NA
Indica Intermediate  786 70.60% 29.30% 0.13% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 56.00% 44.00% 0.00% 0.00% NA
Japonica Intermediate  241 10.40% 89.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018873646 T -> A LOC_Os10g35300.2 3_prime_UTR_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:81.792; most accessible tissue: Callus, score: 94.369 N N N N
vg1018873646 T -> A LOC_Os10g35300.1 3_prime_UTR_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:81.792; most accessible tissue: Callus, score: 94.369 N N N N
vg1018873646 T -> A LOC_Os10g35294.1 downstream_gene_variant ; 556.0bp to feature; MODIFIER silent_mutation Average:81.792; most accessible tissue: Callus, score: 94.369 N N N N
vg1018873646 T -> A LOC_Os10g35294.2 downstream_gene_variant ; 556.0bp to feature; MODIFIER silent_mutation Average:81.792; most accessible tissue: Callus, score: 94.369 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018873646 T A -0.08 -0.04 -0.04 -0.04 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018873646 NA 1.42E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 4.89E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 5.72E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 2.30E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 4.94E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 1.98E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 4.07E-18 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 4.57E-15 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 3.55E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 3.65E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 2.55E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 3.91E-22 mr1539_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 1.32E-20 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 6.88E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 9.65E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 6.97E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 5.96E-21 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 1.15E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 4.37E-14 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 2.48E-11 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 1.68E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 1.38E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 6.79E-06 NA mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 1.13E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018873646 NA 4.15E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251