Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018822915:

Variant ID: vg1018822915 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18822915
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTAATTAGAATCTCAATCTCTAGTCTGTCTTTGGTTGCCGATTAGGGTAGTATCGGGGTTTCAG[C/T]
CGATCTTACCTGATTTAACTACTTTTATCCTATATGCTCGATTGACATGTTAAATCTGCCCTTTATATTAAGATATTGCTGCATTTAAGTATATTAGGCT

Reverse complement sequence

AGCCTAATATACTTAAATGCAGCAATATCTTAATATAAAGGGCAGATTTAACATGTCAATCGAGCATATAGGATAAAAGTAGTTAAATCAGGTAAGATCG[G/A]
CTGAAACCCCGATACTACCCTAATCGGCAACCAAAGACAGACTAGAGATTGAGATTCTAATTACGACTCATAAGATCAAACTCAACTGATGCAGCTATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	42.40%	1.14%	5.56%	NA
All Indica	2759	33.10%	56.40%	1.85%	8.70%	NA
All Japonica	1512	78.70%	20.60%	0.13%	0.60%	NA
Aus	269	57.60%	38.30%	0.00%	4.09%	NA
Indica I	595	11.80%	81.80%	1.01%	5.38%	NA
Indica II	465	69.70%	26.50%	1.29%	2.58%	NA
Indica III	913	25.50%	57.40%	0.88%	16.21%	NA
Indica Intermediate	786	36.30%	53.70%	3.94%	6.11%	NA
Temperate Japonica	767	97.30%	2.70%	0.00%	0.00%	NA
Tropical Japonica	504	45.40%	52.40%	0.40%	1.79%	NA
Japonica Intermediate	241	89.20%	10.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	62.20%	33.30%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018822915	C -> T	LOC_Os10g35220.1	downstream_gene_variant ; 3225.0bp to feature; MODIFIER	silent_mutation	Average:53.254; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg1018822915	C -> T	LOC_Os10g35230.1	downstream_gene_variant ; 760.0bp to feature; MODIFIER	silent_mutation	Average:53.254; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg1018822915	C -> T	LOC_Os10g35220.2	downstream_gene_variant ; 3225.0bp to feature; MODIFIER	silent_mutation	Average:53.254; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg1018822915	C -> T	LOC_Os10g35220-LOC_Os10g35230	intergenic_region ; MODIFIER	silent_mutation	Average:53.254; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg1018822915	C -> DEL	N	N	silent_mutation	Average:53.254; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018822915	NA	5.13E-17	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	2.75E-15	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	1.82E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	1.56E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	3.88E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	6.50E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	1.09E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	4.79E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	2.66E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	5.16E-14	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	1.86E-15	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	6.97E-12	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	1.21E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	2.00E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	2.54E-07	NA	mr1862_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	2.10E-06	mr1862_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018822915	NA	2.72E-13	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251