\
| Variant ID: vg1018676755 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 18676755 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATAAGATGCAACCAATAAATGGTAGATTTTTAAAGATTGATTTTAGAAGAATCTAGTTTAGCTACTGAGTAATGTACAAGAGCTTGCCAAAAGAAGCAA[C/A]
TACGTCTGAGCACATACATACAAAACTGTGGTATGTGAAATGTGATTGGAACAAAATATATATATATACTATATATAGGACACTCATATGGGGCACCATG
CATGGTGCCCCATATGAGTGTCCTATATATAGTATATATATATATTTTGTTCCAATCACATTTCACATACCACAGTTTTGTATGTATGTGCTCAGACGTA[G/T]
TTGCTTCTTTTGGCAAGCTCTTGTACATTACTCAGTAGCTAAACTAGATTCTTCTAAAATCAATCTTTAAAAATCTACCATTTATTGGTTGCATCTTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 1.20% | 0.99% | 0.00% | NA |
| All Indica | 2759 | 96.30% | 2.00% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 6.40% | 6.22% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 1.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1018676755 | C -> A | LOC_Os10g35010.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.708; most accessible tissue: Callus, score: 45.525 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1018676755 | 6.35E-09 | 3.20E-19 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018676755 | 2.34E-06 | 1.23E-12 | mr1141 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018676755 | 1.37E-07 | 1.34E-19 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018676755 | 3.84E-06 | 5.71E-17 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018676755 | NA | 1.06E-14 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |