\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018633254:

Variant ID: vg1018633254 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18633254
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATTATAGTACAATCATGATGTAATTACACTATAACTTGCATGTAACTTTCAAAAATCTCTCCGTAACATGCTATTTCGATGAAACGGAGGTTGTTGG[A/G]
ACAAATCCTCTTACATGTGTGCGCGTAGTGACCTTTTTCCTTCTTCACTTGCATAAATCTTGAAACTAATATAACGGTGGAAAATTATGTGCAAGTTATA

Reverse complement sequence

TATAACTTGCACATAATTTTCCACCGTTATATTAGTTTCAAGATTTATGCAAGTGAAGAAGGAAAAAGGTCACTACGCGCACACATGTAAGAGGATTTGT[T/C]
CCAACAACCTCCGTTTCATCGAAATAGCATGTTACGGAGAGATTTTTGAAAGTTACATGCAAGTTATAGTGTAATTACATCATGATTGTACTATAATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 43.80% 0.25% 1.27% NA
All Indica  2759 70.90% 28.10% 0.29% 0.80% NA
All Japonica  1512 21.40% 78.40% 0.13% 0.00% NA
Aus  269 72.10% 13.40% 0.37% 14.13% NA
Indica I  595 95.30% 4.50% 0.17% 0.00% NA
Indica II  465 35.50% 64.30% 0.00% 0.22% NA
Indica III  913 70.80% 27.60% 0.55% 1.10% NA
Indica Intermediate  786 73.40% 24.90% 0.25% 1.40% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 53.60% 46.00% 0.40% 0.00% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018633254 A -> G LOC_Os10g34896.1 upstream_gene_variant ; 3842.0bp to feature; MODIFIER silent_mutation Average:66.161; most accessible tissue: Callus, score: 91.526 N N N N
vg1018633254 A -> G LOC_Os10g34902.1 upstream_gene_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:66.161; most accessible tissue: Callus, score: 91.526 N N N N
vg1018633254 A -> G LOC_Os10g34910.1 downstream_gene_variant ; 2085.0bp to feature; MODIFIER silent_mutation Average:66.161; most accessible tissue: Callus, score: 91.526 N N N N
vg1018633254 A -> G LOC_Os10g34920.1 downstream_gene_variant ; 4235.0bp to feature; MODIFIER silent_mutation Average:66.161; most accessible tissue: Callus, score: 91.526 N N N N
vg1018633254 A -> G LOC_Os10g34902-LOC_Os10g34910 intergenic_region ; MODIFIER silent_mutation Average:66.161; most accessible tissue: Callus, score: 91.526 N N N N
vg1018633254 A -> DEL N N silent_mutation Average:66.161; most accessible tissue: Callus, score: 91.526 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018633254 NA 1.54E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 9.91E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 3.59E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 7.10E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 9.04E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 1.76E-08 NA mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 6.66E-06 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 1.02E-18 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 5.26E-06 NA mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 7.31E-17 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 2.06E-11 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 3.72E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 3.81E-06 NA mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 3.29E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 3.23E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 5.19E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 4.02E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 2.74E-16 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 4.58E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 4.34E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 2.69E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 6.46E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 1.63E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 1.26E-06 NA mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 2.68E-07 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 1.47E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 5.17E-06 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 1.81E-13 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 3.66E-16 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 2.79E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 4.03E-06 NA mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 1.07E-07 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 9.02E-10 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 3.58E-16 mr1942_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018633254 NA 4.62E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251