\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018510396:

Variant ID: vg1018510396 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 18510396
Reference Allele: TCCAlternative Allele: ACC,T
Primary Allele: ACCSecondary Allele: TCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTGGTACTCCCTCCGTCCCACAGTATAAGGGATTTTGAGTTTTTGATTGTAACGTTTGACCACTCGTCTTATTCAAATTTTTTTTGTAAATATAAAA[TCC/ACC,T]
GAAAAGTTGTGCTTAAAGTACTGTAAATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTCAAAAAAAATTGAATAAGACGAGTGGTCAAACGTTG

Reverse complement sequence

CAACGTTTGACCACTCGTCTTATTCAATTTTTTTTGAAATTATTATTTATTTTATTTGTGACTTACTTTATTATTTACAGTACTTTAAGCACAACTTTTC[GGA/GGT,A]
TTTTATATTTACAAAAAAAATTTGAATAAGACGAGTGGTCAAACGTTACAATCAAAAACTCAAAATCCCTTATACTGTGGGACGGAGGGAGTACCAAATA

Allele Frequencies:

Populations Population SizeFrequency of ACC(primary allele) Frequency of TCC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 27.90% 0.06% 0.00% T: 3.05%
All Indica  2759 97.70% 1.10% 0.11% 0.00% T: 1.12%
All Japonica  1512 18.10% 81.90% 0.00% 0.00% NA
Aus  269 58.70% 0.40% 0.00% 0.00% T: 40.89%
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.00% 0.00% T: 0.43%
Indica III  913 98.40% 0.20% 0.22% 0.00% T: 1.20%
Indica Intermediate  786 96.10% 1.50% 0.13% 0.00% T: 2.29%
Temperate Japonica  767 4.20% 95.80% 0.00% 0.00% NA
Tropical Japonica  504 41.30% 58.70% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.90% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 30.20% 0.00% 0.00% T: 3.12%
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018510396 TCC -> ACC LOC_Os10g34700.1 downstream_gene_variant ; 3984.0bp to feature; MODIFIER silent_mutation Average:47.926; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1018510396 TCC -> ACC LOC_Os10g34700-LOC_Os10g34704 intergenic_region ; MODIFIER silent_mutation Average:47.926; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1018510396 TCC -> T LOC_Os10g34700.1 downstream_gene_variant ; 3985.0bp to feature; MODIFIER silent_mutation Average:47.926; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1018510396 TCC -> T LOC_Os10g34700-LOC_Os10g34704 intergenic_region ; MODIFIER silent_mutation Average:47.926; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018510396 TCC ACC 0.01 0.0 0.0 -0.01 0.01 0.01
vg1018510396 TCC T -0.27 -0.01 -0.02 -0.15 -0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018510396 NA 8.50E-44 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.08E-44 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 5.19E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 7.23E-08 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 2.36E-41 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 3.96E-27 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 2.38E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 2.27E-40 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.62E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 3.84E-06 7.57E-45 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.65E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 6.36E-08 3.20E-42 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 5.62E-15 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 6.20E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 2.74E-08 2.74E-34 mr1862 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.76E-10 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.77E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.48E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.44E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 1.98E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 2.01E-40 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018510396 NA 3.26E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251