Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018432054:

Variant ID: vg1018432054 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18432054
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTGACGGTGGTTGTGATTGACGTGGCTTGCACCTGCAGCATGCATTCACCCAAGTACCCCTCCGTCTCAAGTATTGGATGTCAAGTTGTGAACGCATC[A/C]
TATACTATCCAGATTTGTAGCATTATATTAGAACGGAGGTAGTATTACCGAAAATTGACTTGAAATCAAACCATCACATCTACCCCTCCATTTTATACTT

Reverse complement sequence

AAGTATAAAATGGAGGGGTAGATGTGATGGTTTGATTTCAAGTCAATTTTCGGTAATACTACCTCCGTTCTAATATAATGCTACAAATCTGGATAGTATA[T/G]
GATGCGTTCACAACTTGACATCCAATACTTGAGACGGAGGGGTACTTGGGTGAATGCATGCTGCAGGTGCAAGCCACGTCAATCACAACCACCGTCAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	29.30%	0.02%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	18.30%	81.60%	0.07%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	4.40%	95.40%	0.13%	0.00%	NA
Tropical Japonica	504	42.30%	57.70%	0.00%	0.00%	NA
Japonica Intermediate	241	12.40%	87.60%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018432054	A -> C	LOC_Os10g34560.1	upstream_gene_variant ; 1944.0bp to feature; MODIFIER	silent_mutation	Average:49.147; most accessible tissue: Callus, score: 86.626	N	N	N	N
vg1018432054	A -> C	LOC_Os10g34570.1	upstream_gene_variant ; 902.0bp to feature; MODIFIER	silent_mutation	Average:49.147; most accessible tissue: Callus, score: 86.626	N	N	N	N
vg1018432054	A -> C	LOC_Os10g34580.1	upstream_gene_variant ; 2329.0bp to feature; MODIFIER	silent_mutation	Average:49.147; most accessible tissue: Callus, score: 86.626	N	N	N	N
vg1018432054	A -> C	LOC_Os10g34580.2	upstream_gene_variant ; 2329.0bp to feature; MODIFIER	silent_mutation	Average:49.147; most accessible tissue: Callus, score: 86.626	N	N	N	N
vg1018432054	A -> C	LOC_Os10g34560-LOC_Os10g34570	intergenic_region ; MODIFIER	silent_mutation	Average:49.147; most accessible tissue: Callus, score: 86.626	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018432054	NA	1.57E-17	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	7.72E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	1.47E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	8.43E-09	1.59E-53	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	5.95E-17	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	1.89E-08	3.70E-47	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	6.49E-15	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	8.28E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	9.67E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	1.92E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	1.61E-10	3.34E-33	mr1862	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	5.07E-10	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	4.33E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	7.65E-09	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	2.67E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	4.53E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	3.44E-23	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	4.62E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	5.11E-45	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	6.84E-47	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	4.16E-45	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054	NA	1.54E-08	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251