\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018432054:

Variant ID: vg1018432054 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18432054
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTGACGGTGGTTGTGATTGACGTGGCTTGCACCTGCAGCATGCATTCACCCAAGTACCCCTCCGTCTCAAGTATTGGATGTCAAGTTGTGAACGCATC[A/C]
TATACTATCCAGATTTGTAGCATTATATTAGAACGGAGGTAGTATTACCGAAAATTGACTTGAAATCAAACCATCACATCTACCCCTCCATTTTATACTT

Reverse complement sequence

AAGTATAAAATGGAGGGGTAGATGTGATGGTTTGATTTCAAGTCAATTTTCGGTAATACTACCTCCGTTCTAATATAATGCTACAAATCTGGATAGTATA[T/G]
GATGCGTTCACAACTTGACATCCAATACTTGAGACGGAGGGGTACTTGGGTGAATGCATGCTGCAGGTGCAAGCCACGTCAATCACAACCACCGTCAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 29.30% 0.02% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 18.30% 81.60% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 4.40% 95.40% 0.13% 0.00% NA
Tropical Japonica  504 42.30% 57.70% 0.00% 0.00% NA
Japonica Intermediate  241 12.40% 87.60% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018432054 A -> C LOC_Os10g34560.1 upstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:49.147; most accessible tissue: Callus, score: 86.626 N N N N
vg1018432054 A -> C LOC_Os10g34570.1 upstream_gene_variant ; 902.0bp to feature; MODIFIER silent_mutation Average:49.147; most accessible tissue: Callus, score: 86.626 N N N N
vg1018432054 A -> C LOC_Os10g34580.1 upstream_gene_variant ; 2329.0bp to feature; MODIFIER silent_mutation Average:49.147; most accessible tissue: Callus, score: 86.626 N N N N
vg1018432054 A -> C LOC_Os10g34580.2 upstream_gene_variant ; 2329.0bp to feature; MODIFIER silent_mutation Average:49.147; most accessible tissue: Callus, score: 86.626 N N N N
vg1018432054 A -> C LOC_Os10g34560-LOC_Os10g34570 intergenic_region ; MODIFIER silent_mutation Average:49.147; most accessible tissue: Callus, score: 86.626 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018432054 NA 1.57E-17 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 7.72E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 1.47E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 8.43E-09 1.59E-53 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 5.95E-17 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 1.89E-08 3.70E-47 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 6.49E-15 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 8.28E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 9.67E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 1.92E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 1.61E-10 3.34E-33 mr1862 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 5.07E-10 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 4.33E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 7.65E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 2.67E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 4.53E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 3.44E-23 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 4.62E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 5.11E-45 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 6.84E-47 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 4.16E-45 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018432054 NA 1.54E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251