\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018401992:

Variant ID: vg1018401992 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18401992
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAAATTTGCTACAGGCGTCAAAAAAATACGTAATTAGCTGAGAGACACTAAGAAAACGTGGAACTGTTCCAGGACACTGCAAAATTTGTGAAATTTGC[C/T]
GTAGAACACTGAGCTCATTATTTTATCATTTTCTGGGTGAAAGTGGCGAGTATTTTTTCAAAATGTCTAGATTACCCCGCGTCCCAAACTCAGTCGCCAC

Reverse complement sequence

GTGGCGACTGAGTTTGGGACGCGGGGTAATCTAGACATTTTGAAAAAATACTCGCCACTTTCACCCAGAAAATGATAAAATAATGAGCTCAGTGTTCTAC[G/A]
GCAAATTTCACAAATTTTGCAGTGTCCTGGAACAGTTCCACGTTTTCTTAGTGTCTCTCAGCTAATTACGTATTTTTTTGACGCCTGTAGCAAATTTTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 27.90% 0.13% 0.00% NA
All Indica  2759 98.60% 1.20% 0.18% 0.00% NA
All Japonica  1512 18.60% 81.40% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 97.30% 2.40% 0.34% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.70% 0.38% 0.00% NA
Temperate Japonica  767 4.00% 96.00% 0.00% 0.00% NA
Tropical Japonica  504 42.70% 57.30% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 85.50% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018401992 C -> T LOC_Os10g34490.1 upstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:59.472; most accessible tissue: Callus, score: 95.977 N N N N
vg1018401992 C -> T LOC_Os10g34500.1 downstream_gene_variant ; 2261.0bp to feature; MODIFIER silent_mutation Average:59.472; most accessible tissue: Callus, score: 95.977 N N N N
vg1018401992 C -> T LOC_Os10g34480-LOC_Os10g34490 intergenic_region ; MODIFIER silent_mutation Average:59.472; most accessible tissue: Callus, score: 95.977 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018401992 NA 2.84E-42 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.43E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.05E-08 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 3.17E-40 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.03E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 4.36E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.39E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 4.41E-86 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.25E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.54E-26 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.34E-07 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 5.24E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.18E-12 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.02E-09 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 3.95E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 4.76E-06 2.91E-46 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.40E-14 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 3.63E-42 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.87E-12 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 9.49E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 2.09E-07 3.89E-29 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 2.61E-07 1.97E-12 mr1862 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.90E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 6.79E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 7.64E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.12E-97 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.55E-32 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 3.67E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 3.59E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.18E-44 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.03E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.85E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 1.77E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 7.86E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 2.37E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 5.73E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018401992 NA 9.42E-52 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251