\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018182214:

Variant ID: vg1018182214 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18182214
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.38, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AATCCTAGTATTATATTGCCATTTTCTTAAAAGAATCCTTAATTTTTTGTATTTCTAATATATATATAAATATATAAATGTATTCCCGTATCCTTGTTTT[T/C]
TGGAAAATACCGTATCCATGTATCGACGTATCGAGGTAGCATAGGTTACCATGGGAGATCGAGCCAAGGAGTAAAAAAAAAAGTAAAAGTAACAGCGACG

Reverse complement sequence

CGTCGCTGTTACTTTTACTTTTTTTTTTACTCCTTGGCTCGATCTCCCATGGTAACCTATGCTACCTCGATACGTCGATACATGGATACGGTATTTTCCA[A/G]
AAAACAAGGATACGGGAATACATTTATATATTTATATATATATTAGAAATACAAAAAATTAAGGATTCTTTTAAGAAAATGGCAATATAATACTAGGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 32.50% 1.59% 0.76% NA
All Indica  2759 93.60% 3.70% 2.57% 0.14% NA
All Japonica  1512 14.00% 85.80% 0.20% 0.00% NA
Aus  269 86.20% 1.90% 0.00% 11.90% NA
Indica I  595 90.30% 3.20% 6.55% 0.00% NA
Indica II  465 93.50% 4.70% 1.51% 0.22% NA
Indica III  913 96.30% 2.70% 0.99% 0.00% NA
Indica Intermediate  786 93.10% 4.50% 2.04% 0.38% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 38.10% 61.30% 0.60% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018182214 T -> C LOC_Os10g34064.1 upstream_gene_variant ; 2937.0bp to feature; MODIFIER silent_mutation Average:81.915; most accessible tissue: Callus, score: 99.066 N N N N
vg1018182214 T -> C LOC_Os10g34071.1 upstream_gene_variant ; 4935.0bp to feature; MODIFIER silent_mutation Average:81.915; most accessible tissue: Callus, score: 99.066 N N N N
vg1018182214 T -> C LOC_Os10g34050-LOC_Os10g34064 intergenic_region ; MODIFIER silent_mutation Average:81.915; most accessible tissue: Callus, score: 99.066 N N N N
vg1018182214 T -> DEL N N silent_mutation Average:81.915; most accessible tissue: Callus, score: 99.066 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018182214 T C -0.02 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018182214 NA 4.00E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 7.69E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 8.18E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 7.86E-07 NA mr1104 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 4.96E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 1.96E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 9.53E-39 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 4.25E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 1.02E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 1.87E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 5.98E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 1.39E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 1.34E-38 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018182214 NA 3.61E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251