\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017910378:

Variant ID: vg1017910378 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17910378
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAAACTGCGCGCTCCCCGCCGCCGCCGATGCAGCCGCAACAACACCACCTCCACCGCGCTTCGCCGGCACCGCAGATAACCTGTTTTTTTTTCCTCAT[C/T]
GTGATTTACCGTGAATTAACAACTGCTTGTAAAAAAAAAAAAAAGCAAACCCCCACCGACAACTAATAAAGTGTGCGAAACCGACGAACTCTACCAACGT

Reverse complement sequence

ACGTTGGTAGAGTTCGTCGGTTTCGCACACTTTATTAGTTGTCGGTGGGGGTTTGCTTTTTTTTTTTTTTACAAGCAGTTGTTAATTCACGGTAAATCAC[G/A]
ATGAGGAAAAAAAAACAGGTTATCTGCGGTGCCGGCGAAGCGCGGTGGAGGTGGTGTTGTTGCGGCTGCATCGGCGGCGGCGGGGAGCGCGCAGTTTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 29.30% 0.02% 0.00% NA
All Indica  2759 96.90% 3.10% 0.00% 0.00% NA
All Japonica  1512 21.00% 79.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 88.80% 11.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 37.90% 62.10% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017910378 C -> T LOC_Os10g33800.1 upstream_gene_variant ; 3440.0bp to feature; MODIFIER silent_mutation Average:79.123; most accessible tissue: Minghui63 flower, score: 88.793 N N N N
vg1017910378 C -> T LOC_Os10g33800.2 upstream_gene_variant ; 3440.0bp to feature; MODIFIER silent_mutation Average:79.123; most accessible tissue: Minghui63 flower, score: 88.793 N N N N
vg1017910378 C -> T LOC_Os10g33800.3 upstream_gene_variant ; 3440.0bp to feature; MODIFIER silent_mutation Average:79.123; most accessible tissue: Minghui63 flower, score: 88.793 N N N N
vg1017910378 C -> T LOC_Os10g33790.1 intron_variant ; MODIFIER silent_mutation Average:79.123; most accessible tissue: Minghui63 flower, score: 88.793 N N N N
vg1017910378 C -> T LOC_Os10g33790.2 intron_variant ; MODIFIER silent_mutation Average:79.123; most accessible tissue: Minghui63 flower, score: 88.793 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017910378 C T -0.04 -0.04 -0.06 -0.04 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017910378 2.65E-06 NA mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 1.07E-06 NA mr1135 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 2.50E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 3.22E-08 1.69E-06 mr1504 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 5.74E-29 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 1.84E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 1.68E-10 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 1.56E-25 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 1.12E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 6.13E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 7.55E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 5.62E-21 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 1.13E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017910378 NA 1.84E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251