\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017311816:

Variant ID: vg1017311816 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17311816
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TCACATCCAGTACTAGAATGTTATCCGATACTAAGGGACTCATCTTTTCGCTTATGCTTATACTTATCTACCAAAATTTAAATTTTTAACATAAAAAATT[T/C]
AAAGTTGATTTTGAGGTTTTTTCAATCAAAGTTTATTTTTCAGCCTTTACTTCTAGATTGCTAAAAACACATATATAAAAAATTTATTTAATTTACAAAT

Reverse complement sequence

ATTTGTAAATTAAATAAATTTTTTATATATGTGTTTTTAGCAATCTAGAAGTAAAGGCTGAAAAATAAACTTTGATTGAAAAAACCTCAAAATCAACTTT[A/G]
AATTTTTTATGTTAAAAATTTAAATTTTGGTAGATAAGTATAAGCATAAGCGAAAAGATGAGTCCCTTAGTATCGGATAACATTCTAGTACTGGATGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 46.50% 1.99% 0.04% NA
All Indica  2759 69.00% 30.50% 0.47% 0.00% NA
All Japonica  1512 9.10% 85.80% 4.96% 0.13% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 82.20% 17.50% 0.34% 0.00% NA
Indica II  465 74.00% 25.20% 0.86% 0.00% NA
Indica III  913 58.40% 41.50% 0.11% 0.00% NA
Indica Intermediate  786 68.60% 30.70% 0.76% 0.00% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 7.70% 79.00% 12.90% 0.40% NA
Japonica Intermediate  241 35.30% 61.00% 3.73% 0.00% NA
VI/Aromatic  96 84.40% 14.60% 1.04% 0.00% NA
Intermediate  90 48.90% 45.60% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017311816 T -> C LOC_Os10g33040.1 upstream_gene_variant ; 445.0bp to feature; MODIFIER silent_mutation Average:94.736; most accessible tissue: Zhenshan97 flag leaf, score: 97.299 N N N N
vg1017311816 T -> C LOC_Os10g33050.1 downstream_gene_variant ; 4372.0bp to feature; MODIFIER silent_mutation Average:94.736; most accessible tissue: Zhenshan97 flag leaf, score: 97.299 N N N N
vg1017311816 T -> C LOC_Os10g33030-LOC_Os10g33040 intergenic_region ; MODIFIER silent_mutation Average:94.736; most accessible tissue: Zhenshan97 flag leaf, score: 97.299 N N N N
vg1017311816 T -> DEL N N silent_mutation Average:94.736; most accessible tissue: Zhenshan97 flag leaf, score: 97.299 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017311816 T C -0.02 -0.02 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017311816 NA 2.89E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 2.57E-08 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 3.54E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.31E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 9.94E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 6.31E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 2.12E-07 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 7.69E-06 5.74E-07 mr1344 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.41E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 5.69E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 2.64E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.10E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 2.50E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.85E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 9.80E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 4.83E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 5.61E-08 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.02E-06 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.58E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 2.75E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.72E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 4.49E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311816 NA 1.15E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251