\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017240834:

Variant ID: vg1017240834 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17240834
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCTGGTTTGGATGATATATTTGTCTACCTATTTATCATATGTCTCTGTTAATATAGTCCTAGCATATCAATTTAGCTCTATCGGCTGCTTCTTGTTTT[A/C,T]
GGGTTTCTGCCGGTATCGGCTAAATCGCGTTGCTAGATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAACGGTTTGATTGTCTAAATATT

Reverse complement sequence

AATATTTAGACAATCAAACCGTTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATCTAGCAACGCGATTTAGCCGATACCGGCAGAAACCC[T/G,A]
AAAACAAGAAGCAGCCGATAGAGCTAAATTGATATGCTAGGACTATATTAACAGAGACATATGATAAATAGGTAGACAAATATATCATCCAAACCAGAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 39.90% 0.21% 0.30% T: 0.02%
All Indica  2759 37.00% 62.30% 0.25% 0.43% T: 0.04%
All Japonica  1512 92.30% 7.70% 0.07% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 22.50% 77.00% 0.34% 0.17% NA
Indica II  465 28.40% 71.20% 0.22% 0.22% NA
Indica III  913 48.00% 51.20% 0.33% 0.55% NA
Indica Intermediate  786 40.20% 58.90% 0.13% 0.64% T: 0.13%
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 67.60% 32.00% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017240834 A -> C LOC_Os10g32940.1 upstream_gene_variant ; 3308.0bp to feature; MODIFIER silent_mutation Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1017240834 A -> C LOC_Os10g32930.1 downstream_gene_variant ; 3828.0bp to feature; MODIFIER silent_mutation Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1017240834 A -> C LOC_Os10g32930-LOC_Os10g32940 intergenic_region ; MODIFIER silent_mutation Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1017240834 A -> T LOC_Os10g32940.1 upstream_gene_variant ; 3308.0bp to feature; MODIFIER silent_mutation Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1017240834 A -> T LOC_Os10g32930.1 downstream_gene_variant ; 3828.0bp to feature; MODIFIER silent_mutation Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1017240834 A -> T LOC_Os10g32930-LOC_Os10g32940 intergenic_region ; MODIFIER silent_mutation Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1017240834 A -> DEL N N silent_mutation Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017240834 NA 2.67E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 7.33E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 1.15E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 2.06E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 4.64E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 5.37E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 9.92E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 4.81E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 8.98E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 6.49E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 2.69E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 2.86E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 1.48E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 7.72E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 1.78E-06 5.73E-07 mr1952 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834 NA 1.91E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251