Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1017240834:

Variant ID: vg1017240834 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17240834
Reference Allele: A	Alternative Allele: C,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCTGGTTTGGATGATATATTTGTCTACCTATTTATCATATGTCTCTGTTAATATAGTCCTAGCATATCAATTTAGCTCTATCGGCTGCTTCTTGTTTT[A/C,T]
GGGTTTCTGCCGGTATCGGCTAAATCGCGTTGCTAGATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAACGGTTTGATTGTCTAAATATT

Reverse complement sequence

AATATTTAGACAATCAAACCGTTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATCTAGCAACGCGATTTAGCCGATACCGGCAGAAACCC[T/G,A]
AAAACAAGAAGCAGCCGATAGAGCTAAATTGATATGCTAGGACTATATTAACAGAGACATATGATAAATAGGTAGACAAATATATCATCCAAACCAGAGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	39.90%	0.21%	0.30%	T: 0.02%
All Indica	2759	37.00%	62.30%	0.25%	0.43%	T: 0.04%
All Japonica	1512	92.30%	7.70%	0.07%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	22.50%	77.00%	0.34%	0.17%	NA
Indica II	465	28.40%	71.20%	0.22%	0.22%	NA
Indica III	913	48.00%	51.20%	0.33%	0.55%	NA
Indica Intermediate	786	40.20%	58.90%	0.13%	0.64%	T: 0.13%
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	67.60%	32.00%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	30.00%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017240834	A -> C	LOC_Os10g32940.1	upstream_gene_variant ; 3308.0bp to feature; MODIFIER	silent_mutation	Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1017240834	A -> C	LOC_Os10g32930.1	downstream_gene_variant ; 3828.0bp to feature; MODIFIER	silent_mutation	Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1017240834	A -> C	LOC_Os10g32930-LOC_Os10g32940	intergenic_region ; MODIFIER	silent_mutation	Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1017240834	A -> T	LOC_Os10g32940.1	upstream_gene_variant ; 3308.0bp to feature; MODIFIER	silent_mutation	Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1017240834	A -> T	LOC_Os10g32930.1	downstream_gene_variant ; 3828.0bp to feature; MODIFIER	silent_mutation	Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1017240834	A -> T	LOC_Os10g32930-LOC_Os10g32940	intergenic_region ; MODIFIER	silent_mutation	Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1017240834	A -> DEL	N	N	silent_mutation	Average:32.007; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017240834	NA	2.67E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	7.33E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	1.15E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	2.06E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	4.64E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	5.37E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	9.92E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	4.81E-10	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	8.98E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	6.49E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	2.69E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	2.86E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	1.48E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	7.72E-06	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	1.78E-06	5.73E-07	mr1952	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017240834	NA	1.91E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251