Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1017231804:

Variant ID: vg1017231804 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17231804
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TTATCCTCGTGTTTCTAATTTCCTTAGTTTCTAAAGTCACAACAACTGCTACCCCTTACTTCTGTCATATTATTCTTTATTTGCTTGCTCGATCTACCAC[C/T]
GTTTTCTATTCATTCTCCTTAGAATCTTTATATGTTTTAGAGTTTATTGTCCTATTGGGCATCTTTTTTATAATTTCTAGAAGTCCCGTCAAACACTATC

Reverse complement sequence

GATAGTGTTTGACGGGACTTCTAGAAATTATAAAAAAGATGCCCAATAGGACAATAAACTCTAAAACATATAAAGATTCTAAGGAGAATGAATAGAAAAC[G/A]
GTGGTAGATCGAGCAAGCAAATAAAGAATAATATGACAGAAGTAAGGGGTAGCAGTTGTTGTGACTTTAGAAACTAAGGAAATTAGAAACACGAGGATAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.70%	23.00%	6.71%	3.64%	NA
All Indica	2759	82.30%	1.80%	10.18%	5.65%	NA
All Japonica	1512	31.70%	66.40%	1.52%	0.40%	NA
Aus	269	95.50%	0.40%	2.97%	1.12%	NA
Indica I	595	77.10%	1.70%	16.64%	4.54%	NA
Indica II	465	74.00%	3.70%	11.18%	11.18%	NA
Indica III	913	89.20%	1.00%	6.79%	3.07%	NA
Indica Intermediate	786	83.30%	1.80%	8.65%	6.23%	NA
Temperate Japonica	767	2.20%	97.40%	0.00%	0.39%	NA
Tropical Japonica	504	73.60%	26.00%	0.20%	0.20%	NA
Japonica Intermediate	241	37.80%	52.30%	9.13%	0.83%	NA
VI/Aromatic	96	88.50%	10.40%	0.00%	1.04%	NA
Intermediate	90	63.30%	24.40%	5.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017231804	C -> T	LOC_Os10g32920.1	upstream_gene_variant ; 2434.0bp to feature; MODIFIER	silent_mutation	Average:23.822; most accessible tissue: Callus, score: 52.249	N	N	N	N
vg1017231804	C -> T	LOC_Os10g32930.1	upstream_gene_variant ; 4933.0bp to feature; MODIFIER	silent_mutation	Average:23.822; most accessible tissue: Callus, score: 52.249	N	N	N	N
vg1017231804	C -> T	LOC_Os10g32910.1	downstream_gene_variant ; 4787.0bp to feature; MODIFIER	silent_mutation	Average:23.822; most accessible tissue: Callus, score: 52.249	N	N	N	N
vg1017231804	C -> T	LOC_Os10g32920-LOC_Os10g32930	intergenic_region ; MODIFIER	silent_mutation	Average:23.822; most accessible tissue: Callus, score: 52.249	N	N	N	N
vg1017231804	C -> DEL	N	N	silent_mutation	Average:23.822; most accessible tissue: Callus, score: 52.249	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017231804	NA	2.26E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804	NA	1.52E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804	1.67E-07	1.67E-07	mr1815	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804	NA	5.75E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804	NA	6.55E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804	NA	3.85E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251