\
| Variant ID: vg1017231804 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17231804 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 93. )
TTATCCTCGTGTTTCTAATTTCCTTAGTTTCTAAAGTCACAACAACTGCTACCCCTTACTTCTGTCATATTATTCTTTATTTGCTTGCTCGATCTACCAC[C/T]
GTTTTCTATTCATTCTCCTTAGAATCTTTATATGTTTTAGAGTTTATTGTCCTATTGGGCATCTTTTTTATAATTTCTAGAAGTCCCGTCAAACACTATC
GATAGTGTTTGACGGGACTTCTAGAAATTATAAAAAAGATGCCCAATAGGACAATAAACTCTAAAACATATAAAGATTCTAAGGAGAATGAATAGAAAAC[G/A]
GTGGTAGATCGAGCAAGCAAATAAAGAATAATATGACAGAAGTAAGGGGTAGCAGTTGTTGTGACTTTAGAAACTAAGGAAATTAGAAACACGAGGATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 23.00% | 6.71% | 3.64% | NA |
| All Indica | 2759 | 82.30% | 1.80% | 10.18% | 5.65% | NA |
| All Japonica | 1512 | 31.70% | 66.40% | 1.52% | 0.40% | NA |
| Aus | 269 | 95.50% | 0.40% | 2.97% | 1.12% | NA |
| Indica I | 595 | 77.10% | 1.70% | 16.64% | 4.54% | NA |
| Indica II | 465 | 74.00% | 3.70% | 11.18% | 11.18% | NA |
| Indica III | 913 | 89.20% | 1.00% | 6.79% | 3.07% | NA |
| Indica Intermediate | 786 | 83.30% | 1.80% | 8.65% | 6.23% | NA |
| Temperate Japonica | 767 | 2.20% | 97.40% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 73.60% | 26.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 37.80% | 52.30% | 9.13% | 0.83% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 63.30% | 24.40% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017231804 | C -> T | LOC_Os10g32920.1 | upstream_gene_variant ; 2434.0bp to feature; MODIFIER | silent_mutation | Average:23.822; most accessible tissue: Callus, score: 52.249 | N | N | N | N |
| vg1017231804 | C -> T | LOC_Os10g32930.1 | upstream_gene_variant ; 4933.0bp to feature; MODIFIER | silent_mutation | Average:23.822; most accessible tissue: Callus, score: 52.249 | N | N | N | N |
| vg1017231804 | C -> T | LOC_Os10g32910.1 | downstream_gene_variant ; 4787.0bp to feature; MODIFIER | silent_mutation | Average:23.822; most accessible tissue: Callus, score: 52.249 | N | N | N | N |
| vg1017231804 | C -> T | LOC_Os10g32920-LOC_Os10g32930 | intergenic_region ; MODIFIER | silent_mutation | Average:23.822; most accessible tissue: Callus, score: 52.249 | N | N | N | N |
| vg1017231804 | C -> DEL | N | N | silent_mutation | Average:23.822; most accessible tissue: Callus, score: 52.249 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017231804 | NA | 2.26E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017231804 | NA | 1.52E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017231804 | 1.67E-07 | 1.67E-07 | mr1815 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017231804 | NA | 5.75E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017231804 | NA | 6.55E-25 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017231804 | NA | 3.85E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |