\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017231804:

Variant ID: vg1017231804 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17231804
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TTATCCTCGTGTTTCTAATTTCCTTAGTTTCTAAAGTCACAACAACTGCTACCCCTTACTTCTGTCATATTATTCTTTATTTGCTTGCTCGATCTACCAC[C/T]
GTTTTCTATTCATTCTCCTTAGAATCTTTATATGTTTTAGAGTTTATTGTCCTATTGGGCATCTTTTTTATAATTTCTAGAAGTCCCGTCAAACACTATC

Reverse complement sequence

GATAGTGTTTGACGGGACTTCTAGAAATTATAAAAAAGATGCCCAATAGGACAATAAACTCTAAAACATATAAAGATTCTAAGGAGAATGAATAGAAAAC[G/A]
GTGGTAGATCGAGCAAGCAAATAAAGAATAATATGACAGAAGTAAGGGGTAGCAGTTGTTGTGACTTTAGAAACTAAGGAAATTAGAAACACGAGGATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 23.00% 6.71% 3.64% NA
All Indica  2759 82.30% 1.80% 10.18% 5.65% NA
All Japonica  1512 31.70% 66.40% 1.52% 0.40% NA
Aus  269 95.50% 0.40% 2.97% 1.12% NA
Indica I  595 77.10% 1.70% 16.64% 4.54% NA
Indica II  465 74.00% 3.70% 11.18% 11.18% NA
Indica III  913 89.20% 1.00% 6.79% 3.07% NA
Indica Intermediate  786 83.30% 1.80% 8.65% 6.23% NA
Temperate Japonica  767 2.20% 97.40% 0.00% 0.39% NA
Tropical Japonica  504 73.60% 26.00% 0.20% 0.20% NA
Japonica Intermediate  241 37.80% 52.30% 9.13% 0.83% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 1.04% NA
Intermediate  90 63.30% 24.40% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017231804 C -> T LOC_Os10g32920.1 upstream_gene_variant ; 2434.0bp to feature; MODIFIER silent_mutation Average:23.822; most accessible tissue: Callus, score: 52.249 N N N N
vg1017231804 C -> T LOC_Os10g32930.1 upstream_gene_variant ; 4933.0bp to feature; MODIFIER silent_mutation Average:23.822; most accessible tissue: Callus, score: 52.249 N N N N
vg1017231804 C -> T LOC_Os10g32910.1 downstream_gene_variant ; 4787.0bp to feature; MODIFIER silent_mutation Average:23.822; most accessible tissue: Callus, score: 52.249 N N N N
vg1017231804 C -> T LOC_Os10g32920-LOC_Os10g32930 intergenic_region ; MODIFIER silent_mutation Average:23.822; most accessible tissue: Callus, score: 52.249 N N N N
vg1017231804 C -> DEL N N silent_mutation Average:23.822; most accessible tissue: Callus, score: 52.249 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017231804 NA 2.26E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804 NA 1.52E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804 1.67E-07 1.67E-07 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804 NA 5.75E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804 NA 6.55E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017231804 NA 3.85E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251