Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017221229:

Variant ID: vg1017221229 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 17221229
Reference Allele: T	Alternative Allele: A,TTA,TA,TAA,TAAA,TTTAA
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, A: 0.16, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTTTGAGTACATCGCAAACGAACAGAATTACAAAGAAAGACAATAGGAACTGGAATCCTATATCTTGTGCGACCATGAACTCTTTCATTCTTTTTTTT[T/A,TTA,TA,TAA,TAAA,TTTAA]
AAAAAAATGAAAACCTATATATATCACATACTGTTATCTCTTAATGATCATGTGTTCATGTGTTGAATCAACTAGATAGCAATATCCCTTTTTTCTCGCA

Reverse complement sequence

TGCGAGAAAAAAGGGATATTGCTATCTAGTTGATTCAACACATGAACACATGATCATTAAGAGATAACAGTATGTGATATATATAGGTTTTCATTTTTTT[A/T,TAA,TA,TTA,TTTA,TTAAA]
AAAAAAAAGAATGAAAGAGTTCATGGTCGCACAAGATATAGGATTCCAGTTCCTATTGTCTTTCTTTGTAATTCTGTTCGTTTGCGATGTACTCAAACAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	22.50%	4.21%	0.00%	TTA: 8.04%; TAA: 0.21%; TA: 0.15%; TAAA: 0.11%; TTTAA: 0.02%
All Indica	2759	91.30%	1.50%	6.63%	0.00%	TTA: 0.25%; TA: 0.14%; TAA: 0.07%; TAAA: 0.07%
All Japonica	1512	9.50%	65.40%	0.46%	0.00%	TTA: 24.21%; TAA: 0.40%; TAAA: 0.07%
Aus	269	98.90%	0.00%	0.37%	0.00%	TA: 0.37%; TTA: 0.37%
Indica I	595	83.70%	2.00%	14.29%	0.00%	NA
Indica II	465	90.50%	3.70%	4.95%	0.00%	TTA: 0.65%; TAA: 0.22%
Indica III	913	96.40%	0.20%	3.40%	0.00%	NA
Indica Intermediate	786	91.60%	1.40%	5.60%	0.00%	TA: 0.51%; TTA: 0.51%; TAAA: 0.25%; TAA: 0.13%
Temperate Japonica	767	2.20%	97.10%	0.13%	0.00%	TTA: 0.52%
Tropical Japonica	504	7.50%	24.20%	0.60%	0.00%	TTA: 66.47%; TAA: 1.19%
Japonica Intermediate	241	36.50%	50.60%	1.24%	0.00%	TTA: 11.20%; TAAA: 0.41%
VI/Aromatic	96	85.40%	10.40%	1.04%	0.00%	TAAA: 2.08%; TTTAA: 1.04%
Intermediate	90	57.80%	23.30%	7.78%	0.00%	TTA: 6.67%; TAA: 2.22%; TA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017221229	T -> TAAA	LOC_Os10g32900.1	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TAAA	LOC_Os10g32900.2	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TAAA	LOC_Os10g32880-LOC_Os10g32900	intergenic_region ; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TTTAA	LOC_Os10g32900.1	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TTTAA	LOC_Os10g32900.2	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TTTAA	LOC_Os10g32880-LOC_Os10g32900	intergenic_region ; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TAA	LOC_Os10g32900.1	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TAA	LOC_Os10g32900.2	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TAA	LOC_Os10g32880-LOC_Os10g32900	intergenic_region ; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TA	LOC_Os10g32900.1	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TA	LOC_Os10g32900.2	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TA	LOC_Os10g32880-LOC_Os10g32900	intergenic_region ; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> A	LOC_Os10g32900.1	upstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> A	LOC_Os10g32900.2	upstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> A	LOC_Os10g32880-LOC_Os10g32900	intergenic_region ; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TTA	LOC_Os10g32900.1	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TTA	LOC_Os10g32900.2	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N
vg1017221229	T -> TTA	LOC_Os10g32880-LOC_Os10g32900	intergenic_region ; MODIFIER	silent_mutation	Average:33.495; most accessible tissue: Callus, score: 68.543	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017221229	NA	3.02E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	8.43E-06	NA	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.17E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.02E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	3.05E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	3.83E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	2.59E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.45E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.80E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	7.55E-06	NA	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	1.06E-06	NA	mr1511	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	9.75E-06	mr1511	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	3.90E-20	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	8.26E-06	mr1528	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.20E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.11E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.77E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	2.60E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	4.99E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	2.83E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	3.51E-26	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	4.13E-11	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	2.05E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.23E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	4.30E-08	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	3.95E-06	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.13E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	3.31E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	3.57E-08	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	8.35E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	2.32E-25	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.08E-11	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	7.47E-09	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	7.14E-06	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.03E-09	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	1.70E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	5.36E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	6.25E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	6.94E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017221229	NA	6.22E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251