Variant ID: vg1017197950 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 17197950 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, G: 0.45, others allele: 0.00, population size: 103. )
TAGAGTGGTTTATAATTCACAGCTTAGACTTTGGTCAATAAGACAAACATGTAGTGTTGGTATTTCCTCCGTTCCATAATATAAGGGATTTTGACTTTTT[G/T]
CTTATATTGTTTGACCATTCGTCTTATTTAAAAACATTTAGAATTATTATTTATTTTATTTGTGACTTACTTTATTATCCAAAATACTTTAAGCACAATT
AATTGTGCTTAAAGTATTTTGGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTCTAAATGTTTTTAAATAAGACGAATGGTCAAACAATATAAG[C/A]
AAAAAGTCAAAATCCCTTATATTATGGAACGGAGGAAATACCAACACTACATGTTTGTCTTATTGACCAAAGTCTAAGCTGTGAATTATAAACCACTCTA
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.00% | 4.00% | 0.02% | 0.00% | NA |
All Indica | 2759 | 93.50% | 6.50% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 83.50% | 16.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 93.80% | 6.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1017197950 | G -> T | LOC_Os10g32850.1 | upstream_gene_variant ; 2874.0bp to feature; MODIFIER | silent_mutation | Average:52.864; most accessible tissue: Callus, score: 70.917 | N | N | N | N |
vg1017197950 | G -> T | LOC_Os10g32860.2 | upstream_gene_variant ; 488.0bp to feature; MODIFIER | silent_mutation | Average:52.864; most accessible tissue: Callus, score: 70.917 | N | N | N | N |
vg1017197950 | G -> T | LOC_Os10g32860.1 | upstream_gene_variant ; 488.0bp to feature; MODIFIER | silent_mutation | Average:52.864; most accessible tissue: Callus, score: 70.917 | N | N | N | N |
vg1017197950 | G -> T | LOC_Os10g32870.1 | downstream_gene_variant ; 3845.0bp to feature; MODIFIER | silent_mutation | Average:52.864; most accessible tissue: Callus, score: 70.917 | N | N | N | N |
vg1017197950 | G -> T | LOC_Os10g32850-LOC_Os10g32860 | intergenic_region ; MODIFIER | silent_mutation | Average:52.864; most accessible tissue: Callus, score: 70.917 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1017197950 | NA | 8.84E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 2.96E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 3.26E-09 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 7.37E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 4.62E-07 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 8.39E-06 | mr1511 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 6.72E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 4.99E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 2.62E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | 7.34E-06 | 5.80E-07 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | 1.10E-06 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | 9.19E-06 | 1.98E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 2.07E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1017197950 | NA | 5.13E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |