\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017197950:

Variant ID: vg1017197950 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17197950
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, G: 0.45, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAGTGGTTTATAATTCACAGCTTAGACTTTGGTCAATAAGACAAACATGTAGTGTTGGTATTTCCTCCGTTCCATAATATAAGGGATTTTGACTTTTT[G/T]
CTTATATTGTTTGACCATTCGTCTTATTTAAAAACATTTAGAATTATTATTTATTTTATTTGTGACTTACTTTATTATCCAAAATACTTTAAGCACAATT

Reverse complement sequence

AATTGTGCTTAAAGTATTTTGGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTCTAAATGTTTTTAAATAAGACGAATGGTCAAACAATATAAG[C/A]
AAAAAGTCAAAATCCCTTATATTATGGAACGGAGGAAATACCAACACTACATGTTTGTCTTATTGACCAAAGTCTAAGCTGTGAATTATAAACCACTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 4.00% 0.02% 0.00% NA
All Indica  2759 93.50% 6.50% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 83.50% 16.50% 0.00% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 93.80% 6.10% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017197950 G -> T LOC_Os10g32850.1 upstream_gene_variant ; 2874.0bp to feature; MODIFIER silent_mutation Average:52.864; most accessible tissue: Callus, score: 70.917 N N N N
vg1017197950 G -> T LOC_Os10g32860.2 upstream_gene_variant ; 488.0bp to feature; MODIFIER silent_mutation Average:52.864; most accessible tissue: Callus, score: 70.917 N N N N
vg1017197950 G -> T LOC_Os10g32860.1 upstream_gene_variant ; 488.0bp to feature; MODIFIER silent_mutation Average:52.864; most accessible tissue: Callus, score: 70.917 N N N N
vg1017197950 G -> T LOC_Os10g32870.1 downstream_gene_variant ; 3845.0bp to feature; MODIFIER silent_mutation Average:52.864; most accessible tissue: Callus, score: 70.917 N N N N
vg1017197950 G -> T LOC_Os10g32850-LOC_Os10g32860 intergenic_region ; MODIFIER silent_mutation Average:52.864; most accessible tissue: Callus, score: 70.917 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017197950 NA 8.84E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 2.96E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 3.26E-09 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 7.37E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 4.62E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 8.39E-06 mr1511 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 6.72E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 4.99E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 2.62E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 7.34E-06 5.80E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 1.10E-06 NA mr1798 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 9.19E-06 1.98E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 2.07E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017197950 NA 5.13E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251