\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017179262:

Variant ID: vg1017179262 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 17179262
Reference Allele: GAlternative Allele: GATTTAC,C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGCAGCTCCCCCGTGCACAAACACAATTAGTAAATGACATTGGGCACAAACACTATATATTGATTAAACAAGGTTAGTTTCTCAGTTCAGAAGATTTA[G/GATTTAC,C]
TGAAGCGACCAAGGTGGCAGGTAAAGCTCTCACATGGTGGAAGCAGTGGTAGAGCCAGATGAGCTGCACGTCTGGAGGCGGCACCAGCATCGGCGCCTCC

Reverse complement sequence

GGAGGCGCCGATGCTGGTGCCGCCTCCAGACGTGCAGCTCATCTGGCTCTACCACTGCTTCCACCATGTGAGAGCTTTACCTGCCACCTTGGTCGCTTCA[C/GTAAATC,G]
TAAATCTTCTGAACTGAGAAACTAACCTTGTTTAATCAATATATAGTGTTTGTGCCCAATGTCATTTACTAATTGTGTTTGTGCACGGGGGAGCTGCTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 19.60% 0.06% 0.00% GATTTAC: 5.18%
All Indica  2759 90.30% 0.80% 0.11% 0.00% GATTTAC: 8.81%
All Japonica  1512 41.90% 58.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.30% 0.17% 0.00% GATTTAC: 1.01%
Indica II  465 94.20% 1.90% 0.00% 0.00% GATTTAC: 3.87%
Indica III  913 80.40% 0.10% 0.11% 0.00% GATTTAC: 19.39%
Indica Intermediate  786 93.10% 1.40% 0.13% 0.00% GATTTAC: 5.34%
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 0.00% 0.00% GATTTAC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017179262 G -> C LOC_Os10g32810.1 upstream_gene_variant ; 1495.0bp to feature; MODIFIER silent_mutation Average:94.684; most accessible tissue: Zhenshan97 panicle, score: 98.582 N N N N
vg1017179262 G -> C LOC_Os10g32800.1 downstream_gene_variant ; 764.0bp to feature; MODIFIER silent_mutation Average:94.684; most accessible tissue: Zhenshan97 panicle, score: 98.582 N N N N
vg1017179262 G -> C LOC_Os10g32800-LOC_Os10g32810 intergenic_region ; MODIFIER silent_mutation Average:94.684; most accessible tissue: Zhenshan97 panicle, score: 98.582 N N N N
vg1017179262 G -> GATTTAC LOC_Os10g32810.1 upstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:94.684; most accessible tissue: Zhenshan97 panicle, score: 98.582 N N N N
vg1017179262 G -> GATTTAC LOC_Os10g32800.1 downstream_gene_variant ; 765.0bp to feature; MODIFIER silent_mutation Average:94.684; most accessible tissue: Zhenshan97 panicle, score: 98.582 N N N N
vg1017179262 G -> GATTTAC LOC_Os10g32800-LOC_Os10g32810 intergenic_region ; MODIFIER silent_mutation Average:94.684; most accessible tissue: Zhenshan97 panicle, score: 98.582 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017179262 G C -0.08 -0.02 -0.03 -0.03 -0.04 -0.05
vg1017179262 G GATTT* 0.06 0.11 0.06 -0.1 -0.03 0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017179262 NA 2.46E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017179262 NA 4.88E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 6.88E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 2.00E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 6.61E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.46E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.10E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.13E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 2.81E-08 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.41E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 6.29E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.08E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 2.87E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.09E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.69E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.05E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.49E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.04E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.50E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.21E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 6.52E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 5.63E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 4.80E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 7.20E-06 NA mr1727 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.07E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 5.48E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.75E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.06E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 4.75E-07 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.16E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 3.93E-07 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 4.94E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 4.96E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 4.03E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 8.62E-13 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.11E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.06E-37 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 1.26E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017179262 NA 7.89E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251