\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017128609:

Variant ID: vg1017128609 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17128609
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCAATATGGATACAATCTGAGTAGTACTTGTCGTTTCCATGTATAACTCTAGTTGTCTTTCCTTATCCAAAACTCCCTCCATATCCGAGGTCAGTTT[T/C]
CATATAAGACATGGTATATGGTGGGTCCTGTCAAGATTTAATCAACTACTATTAGGTATATGGTATCTATAACCCTGACATCTGTTAGGGCATATTTTGA

Reverse complement sequence

TCAAAATATGCCCTAACAGATGTCAGGGTTATAGATACCATATACCTAATAGTAGTTGATTAAATCTTGACAGGACCCACCATATACCATGTCTTATATG[A/G]
AAACTGACCTCGGATATGGAGGGAGTTTTGGATAAGGAAAGACAACTAGAGTTATACATGGAAACGACAAGTACTACTCAGATTGTATCCATATTGGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 24.00% 14.39% 6.01% NA
All Indica  2759 60.20% 8.20% 22.47% 9.13% NA
All Japonica  1512 38.90% 58.30% 2.18% 0.60% NA
Aus  269 90.30% 0.40% 4.09% 5.20% NA
Indica I  595 39.30% 18.00% 38.15% 4.54% NA
Indica II  465 60.40% 10.10% 22.80% 6.67% NA
Indica III  913 73.10% 0.40% 13.36% 13.14% NA
Indica Intermediate  786 60.90% 8.70% 20.99% 9.41% NA
Temperate Japonica  767 3.90% 95.40% 0.65% 0.00% NA
Tropical Japonica  504 90.90% 8.30% 0.60% 0.20% NA
Japonica Intermediate  241 41.50% 44.80% 10.37% 3.32% NA
VI/Aromatic  96 87.50% 1.00% 4.17% 7.29% NA
Intermediate  90 57.80% 26.70% 13.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017128609 T -> C LOC_Os10g32710.1 upstream_gene_variant ; 3833.0bp to feature; MODIFIER silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017128609 T -> C LOC_Os10g32710.2 upstream_gene_variant ; 3833.0bp to feature; MODIFIER silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017128609 T -> C LOC_Os10g32710.3 upstream_gene_variant ; 3833.0bp to feature; MODIFIER silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017128609 T -> C LOC_Os10g32720.1 downstream_gene_variant ; 3307.0bp to feature; MODIFIER silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017128609 T -> C LOC_Os10g32730.1 downstream_gene_variant ; 4543.0bp to feature; MODIFIER silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017128609 T -> C LOC_Os10g32730.2 downstream_gene_variant ; 4543.0bp to feature; MODIFIER silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017128609 T -> C LOC_Os10g32710-LOC_Os10g32720 intergenic_region ; MODIFIER silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1017128609 T -> DEL N N silent_mutation Average:29.229; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017128609 NA 3.97E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 3.33E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 9.85E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 6.32E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.38E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.23E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.86E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.09E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.07E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.95E-06 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 8.83E-08 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 3.45E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.70E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 6.80E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 2.53E-06 NA mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 8.52E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 5.04E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.05E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 8.44E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.51E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 7.26E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 6.42E-17 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.72E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.29E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 9.98E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 2.98E-06 6.23E-09 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 9.78E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 1.44E-06 1.30E-24 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 6.34E-10 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 2.02E-06 7.38E-13 mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 7.35E-08 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 4.39E-06 1.14E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.43E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.26E-17 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 3.30E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.96E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 4.11E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 3.78E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 4.98E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.75E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.81E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 7.88E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.33E-09 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.65E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.45E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 3.36E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 3.37E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 1.20E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.73E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.77E-06 mr1903 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 4.95E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017128609 NA 2.35E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251