\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017105232:

Variant ID: vg1017105232 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17105232
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GGACCAAACTGCTGCTGCTGCTGCTCGGCCTGCTGCTGCATCCTCTGGTACATCTGCTGGTGCTGCTGCTACATCTGCTGCATCATGGCTGTCATCATCT[G/A]
CGTCTGATGAGCCATTACTTGGGCAAGGGTCGGATTCTCGGGGAGTGGTGGCGGACCATTGCCGGAATCGCTGTTGGGATGCACCCCATCAGTGCGTTCT

Reverse complement sequence

AGAACGCACTGATGGGGTGCATCCCAACAGCGATTCCGGCAATGGTCCGCCACCACTCCCCGAGAATCCGACCCTTGCCCAAGTAATGGCTCATCAGACG[C/T]
AGATGATGACAGCCATGATGCAGCAGATGTAGCAGCAGCACCAGCAGATGTACCAGAGGATGCAGCAGCAGGCCGAGCAGCAGCAGCAGCAGTTTGGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 17.50% 1.23% 3.05% NA
All Indica  2759 93.50% 3.20% 1.20% 2.07% NA
All Japonica  1512 66.00% 27.40% 1.12% 5.42% NA
Aus  269 15.60% 81.80% 1.86% 0.74% NA
Indica I  595 97.50% 1.00% 0.84% 0.67% NA
Indica II  465 97.00% 0.60% 1.08% 1.29% NA
Indica III  913 90.30% 4.40% 1.53% 3.83% NA
Indica Intermediate  786 92.40% 5.00% 1.15% 1.53% NA
Temperate Japonica  767 97.50% 2.20% 0.13% 0.13% NA
Tropical Japonica  504 14.50% 69.20% 2.38% 13.89% NA
Japonica Intermediate  241 73.40% 20.30% 1.66% 4.56% NA
VI/Aromatic  96 10.40% 87.50% 1.04% 1.04% NA
Intermediate  90 73.30% 22.20% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017105232 G -> A LOC_Os10g32658.1 downstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:67.906; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg1017105232 G -> A LOC_Os10g32670.1 downstream_gene_variant ; 2353.0bp to feature; MODIFIER silent_mutation Average:67.906; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg1017105232 G -> A LOC_Os10g32649.1 intron_variant ; MODIFIER silent_mutation Average:67.906; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg1017105232 G -> DEL N N silent_mutation Average:67.906; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017105232 NA 4.31E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017105232 NA 3.93E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 2.53E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 2.78E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 1.82E-07 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 5.99E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 1.11E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 2.15E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 8.82E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 2.47E-07 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 6.18E-07 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 2.03E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 4.77E-09 mr1425 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 6.07E-07 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 9.69E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 1.59E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 3.96E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 1.81E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 3.18E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 4.15E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 3.63E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 3.32E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 7.38E-10 mr1733 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 6.93E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 6.48E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 1.35E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 9.15E-07 mr1903 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 3.11E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 2.36E-07 NA mr1517_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 2.91E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 2.53E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017105232 NA 4.11E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251