\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017015778:

Variant ID: vg1017015778 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 17015778
Reference Allele: ACCCATGTGGGAlternative Allele: GCCCATGTGGG,A
Primary Allele: ACCCATGTGGGSecondary Allele: GCCCATGTGGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCTCGGCGCGAGTGAAGAGGAGCCAGAGAGAGACAGAAGAAAAAAAGAGAGAGAAGGGGAAACGGAGAGGAAGATGACGTGTGATACTAATATGTGGG[ACCCATGTGGG/GCCCATGTGGG,A]
GCCCATGCTGACTCAGCGCCACGTAGACCAAAACCAGTATCAAAACAACCGAAGGATCTCGGGTGATCGGTTTTGCAGAGTTAAGGGACCCCGCATATCT

Reverse complement sequence

AGATATGCGGGGTCCCTTAACTCTGCAAAACCGATCACCCGAGATCCTTCGGTTGTTTTGATACTGGTTTTGGTCTACGTGGCGCTGAGTCAGCATGGGC[CCCACATGGGT/CCCACATGGGC,T]
CCCACATATTAGTATCACACGTCATCTTCCTCTCCGTTTCCCCTTCTCTCTCTTTTTTTCTTCTGTCTCTCTCTGGCTCCTCTTCACTCGCGCCGAGCAA

Allele Frequencies:

Populations Population SizeFrequency of ACCCATGTGGG(primary allele) Frequency of GCCCATGTGGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 11.70% 3.07% 7.87% NA
All Indica  2759 91.00% 0.50% 3.04% 5.44% NA
All Japonica  1512 62.00% 32.70% 1.39% 3.97% NA
Aus  269 51.70% 2.60% 13.01% 32.71% NA
Indica I  595 91.90% 0.00% 6.39% 1.68% NA
Indica II  465 85.20% 0.90% 3.66% 10.32% NA
Indica III  913 93.00% 0.10% 0.88% 6.02% NA
Indica Intermediate  786 91.50% 1.10% 2.67% 4.71% NA
Temperate Japonica  767 96.50% 2.50% 0.26% 0.78% NA
Tropical Japonica  504 11.30% 82.90% 1.98% 3.77% NA
Japonica Intermediate  241 58.10% 23.70% 3.73% 14.52% NA
VI/Aromatic  96 7.30% 25.00% 2.08% 65.62% NA
Intermediate  90 67.80% 16.70% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017015778 ACCCATGTGGG -> DEL N N silent_mutation Average:92.495; most accessible tissue: Zhenshan97 panicle, score: 98.444 N N N N
vg1017015778 ACCCATGTGGG -> A LOC_Os10g32470.1 upstream_gene_variant ; 4764.0bp to feature; MODIFIER N Average:92.495; most accessible tissue: Zhenshan97 panicle, score: 98.444 N N N N
vg1017015778 ACCCATGTGGG -> A LOC_Os10g32500.1 upstream_gene_variant ; 3143.0bp to feature; MODIFIER N Average:92.495; most accessible tissue: Zhenshan97 panicle, score: 98.444 N N N N
vg1017015778 ACCCATGTGGG -> A LOC_Os10g32470-LOC_Os10g32500 intergenic_region ; MODIFIER N Average:92.495; most accessible tissue: Zhenshan97 panicle, score: 98.444 N N N N
vg1017015778 ACCCATGTGGG -> GCCCATGTGGG LOC_Os10g32470.1 upstream_gene_variant ; 4763.0bp to feature; MODIFIER silent_mutation Average:92.495; most accessible tissue: Zhenshan97 panicle, score: 98.444 N N N N
vg1017015778 ACCCATGTGGG -> GCCCATGTGGG LOC_Os10g32500.1 upstream_gene_variant ; 3144.0bp to feature; MODIFIER silent_mutation Average:92.495; most accessible tissue: Zhenshan97 panicle, score: 98.444 N N N N
vg1017015778 ACCCATGTGGG -> GCCCATGTGGG LOC_Os10g32470-LOC_Os10g32500 intergenic_region ; MODIFIER silent_mutation Average:92.495; most accessible tissue: Zhenshan97 panicle, score: 98.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017015778 ACCCA* A -0.27 -0.19 -0.09 -0.36 -0.29 -0.25
vg1017015778 ACCCA* GCCCA* 0.0 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017015778 NA 6.97E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.01E-06 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 8.83E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 9.73E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 6.93E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 1.82E-06 8.12E-07 mr1075 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 6.15E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 9.23E-06 NA mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 4.20E-06 NA mr1112 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 1.30E-06 NA mr1112 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 8.06E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 3.21E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 5.95E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.49E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 3.48E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.03E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 3.73E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.59E-06 mr1263 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 3.37E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 4.99E-06 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 2.96E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.59E-06 mr1451 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 7.25E-06 9.07E-06 mr1472 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 2.45E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 3.49E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 6.66E-12 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 7.98E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.01E-17 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.50E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.34E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 7.09E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 8.45E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.62E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 8.93E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.22E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 8.89E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 9.46E-09 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.68E-16 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 4.39E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 4.47E-06 4.45E-06 mr1736 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.31E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 3.19E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 8.89E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 6.85E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 4.68E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.76E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 4.01E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 1.71E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017015778 NA 9.70E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251