\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016784631:

Variant ID: vg1016784631 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16784631
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGCTGAAACACAACCAAATCATCTCATGAAACATTTGCTACAACATATGAAAAAACGGTTTCTAAAAAATCGAGTGTTGTTTCACCCTATATAAAA[T/C]
AAATGTTTCAGCGAATAGCGAAATGATGCTTCAATTCACTACAACATTCGATCTATGCATAGTGAAACATCACGAGTACACTTACTCAAACATTATTGGT

Reverse complement sequence

ACCAATAATGTTTGAGTAAGTGTACTCGTGATGTTTCACTATGCATAGATCGAATGTTGTAGTGAATTGAAGCATCATTTCGCTATTCGCTGAAACATTT[A/G]
TTTTATATAGGGTGAAACAACACTCGATTTTTTAGAAACCGTTTTTTCATATGTTGTAGCAAATGTTTCATGAGATGATTTGGTTGTGTTTCAGCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 27.30% 0.02% 0.00% NA
All Indica  2759 98.80% 1.20% 0.04% 0.00% NA
All Japonica  1512 18.80% 81.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 3.30% 96.70% 0.00% 0.00% NA
Tropical Japonica  504 34.10% 65.90% 0.00% 0.00% NA
Japonica Intermediate  241 36.50% 63.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016784631 T -> C LOC_Os10g31970.1 upstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:48.091; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1016784631 T -> C LOC_Os10g31950.1 downstream_gene_variant ; 4947.0bp to feature; MODIFIER silent_mutation Average:48.091; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1016784631 T -> C LOC_Os10g31950-LOC_Os10g31970 intergenic_region ; MODIFIER silent_mutation Average:48.091; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016784631 NA 1.26E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 8.85E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 3.89E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 2.89E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 2.40E-06 NA mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 1.28E-41 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 2.18E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 6.85E-28 mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 3.70E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 7.86E-22 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 4.13E-28 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 5.36E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 8.89E-22 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 3.48E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 1.93E-50 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 1.45E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 7.27E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 2.08E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631 NA 4.87E-20 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251