Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016784631:

Variant ID: vg1016784631 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16784631
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAGCTGAAACACAACCAAATCATCTCATGAAACATTTGCTACAACATATGAAAAAACGGTTTCTAAAAAATCGAGTGTTGTTTCACCCTATATAAAA[T/C]
AAATGTTTCAGCGAATAGCGAAATGATGCTTCAATTCACTACAACATTCGATCTATGCATAGTGAAACATCACGAGTACACTTACTCAAACATTATTGGT

Reverse complement sequence

ACCAATAATGTTTGAGTAAGTGTACTCGTGATGTTTCACTATGCATAGATCGAATGTTGTAGTGAATTGAAGCATCATTTCGCTATTCGCTGAAACATTT[A/G]
TTTTATATAGGGTGAAACAACACTCGATTTTTTAGAAACCGTTTTTTCATATGTTGTAGCAAATGTTTCATGAGATGATTTGGTTGTGTTTCAGCTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.70%	27.30%	0.02%	0.00%	NA
All Indica	2759	98.80%	1.20%	0.04%	0.00%	NA
All Japonica	1512	18.80%	81.20%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	34.10%	65.90%	0.00%	0.00%	NA
Japonica Intermediate	241	36.50%	63.50%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016784631	T -> C	LOC_Os10g31970.1	upstream_gene_variant ; 2986.0bp to feature; MODIFIER	silent_mutation	Average:48.091; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg1016784631	T -> C	LOC_Os10g31950.1	downstream_gene_variant ; 4947.0bp to feature; MODIFIER	silent_mutation	Average:48.091; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg1016784631	T -> C	LOC_Os10g31950-LOC_Os10g31970	intergenic_region ; MODIFIER	silent_mutation	Average:48.091; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016784631	NA	1.26E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	8.85E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	3.89E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	2.89E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	2.40E-06	NA	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	1.28E-41	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	2.18E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	6.85E-28	mr1548	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	3.70E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	7.86E-22	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	4.13E-28	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	5.36E-10	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	8.89E-22	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	3.48E-19	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	1.93E-50	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	1.45E-12	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	7.27E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	2.08E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016784631	NA	4.87E-20	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251