\
| Variant ID: vg1016644917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16644917 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATTGATTTGGATTTTAATTACTATAAACTTAAAAAATGGATTTATATGATATTTTTAAAGCAATTTCTATATAAAAAGTTTCACACAAAATACATCCTTT[G/A]
GCAGTTTGAAAAAACGTGTTAATGAAAACCGAGGTATAATCTGTATTTATCTTAATCTAGTTTGAACGGGGACTAATACTTTGACTTCACTTAATTATGC
GCATAATTAAGTGAAGTCAAAGTATTAGTCCCCGTTCAAACTAGATTAAGATAAATACAGATTATACCTCGGTTTTCATTAACACGTTTTTTCAAACTGC[C/T]
AAAGGATGTATTTTGTGTGAAACTTTTTATATAGAAATTGCTTTAAAAATATCATATAAATCCATTTTTTAAGTTTATAGTAATTAAAATCCAAATCAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.30% | 23.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 32.50% | 67.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 46.30% | 53.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.90% | 58.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 38.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016644917 | G -> A | LOC_Os10g31740.1 | upstream_gene_variant ; 4205.0bp to feature; MODIFIER | silent_mutation | Average:44.038; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg1016644917 | G -> A | LOC_Os10g31760.1 | downstream_gene_variant ; 3899.0bp to feature; MODIFIER | silent_mutation | Average:44.038; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg1016644917 | G -> A | LOC_Os10g31750.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.038; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016644917 | NA | 2.83E-17 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | 7.16E-06 | NA | mr1283 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 4.46E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 3.55E-15 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 1.27E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 2.14E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 5.30E-13 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 3.49E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 1.16E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 6.80E-19 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 4.47E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 8.03E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016644917 | NA | 3.77E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |