\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016644917:

Variant ID: vg1016644917 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16644917
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGATTTGGATTTTAATTACTATAAACTTAAAAAATGGATTTATATGATATTTTTAAAGCAATTTCTATATAAAAAGTTTCACACAAAATACATCCTTT[G/A]
GCAGTTTGAAAAAACGTGTTAATGAAAACCGAGGTATAATCTGTATTTATCTTAATCTAGTTTGAACGGGGACTAATACTTTGACTTCACTTAATTATGC

Reverse complement sequence

GCATAATTAAGTGAAGTCAAAGTATTAGTCCCCGTTCAAACTAGATTAAGATAAATACAGATTATACCTCGGTTTTCATTAACACGTTTTTTCAAACTGC[C/T]
AAAGGATGTATTTTGTGTGAAACTTTTTATATAGAAATTGCTTTAAAAATATCATATAAATCCATTTTTTAAGTTTATAGTAATTAAAATCCAAATCAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 23.60% 0.11% 0.00% NA
All Indica  2759 98.90% 1.10% 0.04% 0.00% NA
All Japonica  1512 32.50% 67.30% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 46.30% 53.50% 0.26% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016644917 G -> A LOC_Os10g31740.1 upstream_gene_variant ; 4205.0bp to feature; MODIFIER silent_mutation Average:44.038; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg1016644917 G -> A LOC_Os10g31760.1 downstream_gene_variant ; 3899.0bp to feature; MODIFIER silent_mutation Average:44.038; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg1016644917 G -> A LOC_Os10g31750.1 intron_variant ; MODIFIER silent_mutation Average:44.038; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016644917 NA 2.83E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 7.16E-06 NA mr1283 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 4.46E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 3.55E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 1.27E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 2.14E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 5.30E-13 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 3.49E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 1.16E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 6.80E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 4.47E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 8.03E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016644917 NA 3.77E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251