Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016361251:

Variant ID: vg1016361251 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16361251
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCAAAGTGCATATGATAACTCGACGAATCACATAAACAATATTAGAGTGTCATAAAGATGGAAGCACTAATCCCGAGAACGCAAGCCGTCATGACAAG[C/T]
TTACCTCTAGTTGAAGATCGTGATCGATGTAGTTCAACCCGAAAGCAAAAACTCGTCGAAATAAAACGAAAGTGAAAAGGGTGGCGATGCGCCGAAAGTG

Reverse complement sequence

CACTTTCGGCGCATCGCCACCCTTTTCACTTTCGTTTTATTTCGACGAGTTTTTGCTTTCGGGTTGAACTACATCGATCACGATCTTCAACTAGAGGTAA[G/A]
CTTGTCATGACGGCTTGCGTTCTCGGGATTAGTGCTTCCATCTTTATGACACTCTAATATTGTTTATGTGATTCGTCGAGTTATCATATGCACTTTGGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.70%	15.80%	0.30%	41.22%	NA
All Indica	2759	32.70%	1.10%	0.47%	65.75%	NA
All Japonica	1512	49.50%	46.20%	0.07%	4.30%	NA
Aus	269	97.40%	0.40%	0.00%	2.23%	NA
Indica I	595	32.10%	0.80%	0.84%	66.22%	NA
Indica II	465	22.80%	2.40%	0.00%	74.84%	NA
Indica III	913	37.10%	0.10%	0.33%	62.43%	NA
Indica Intermediate	786	34.00%	1.50%	0.64%	63.87%	NA
Temperate Japonica	767	14.00%	84.70%	0.13%	1.17%	NA
Tropical Japonica	504	94.20%	1.20%	0.00%	4.56%	NA
Japonica Intermediate	241	68.90%	17.40%	0.00%	13.69%	NA
VI/Aromatic	96	69.80%	0.00%	0.00%	30.21%	NA
Intermediate	90	43.30%	18.90%	0.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016361251	C -> T	LOC_Os10g31200.1	downstream_gene_variant ; 1663.0bp to feature; MODIFIER	silent_mutation	Average:20.621; most accessible tissue: Zhenshan97 young leaf, score: 37.835	N	N	N	N
vg1016361251	C -> T	LOC_Os10g31200-LOC_Os10g31220	intergenic_region ; MODIFIER	silent_mutation	Average:20.621; most accessible tissue: Zhenshan97 young leaf, score: 37.835	N	N	N	N
vg1016361251	C -> DEL	N	N	silent_mutation	Average:20.621; most accessible tissue: Zhenshan97 young leaf, score: 37.835	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016361251	NA	4.85E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.33E-08	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	9.26E-06	mr1029	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	4.49E-16	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	4.57E-09	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	1.29E-16	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	5.18E-09	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	7.16E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.56E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	9.31E-40	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	7.17E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	1.73E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	5.69E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.03E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.29E-22	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.75E-07	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.52E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	1.64E-08	mr1770	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.53E-32	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	5.78E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	1.07E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	1.25E-13	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	5.31E-22	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	4.81E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016361251	NA	2.67E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251