\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016355947:

Variant ID: vg1016355947 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16355947
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATCTGTGCGAAATGAATGGCGTGTAGACTAAAGGGGGAAAGAAATATTTCATGACACTGATAGATGATTGCACTAGATTCTGCTATGTGTACCTATT[A/G]
AAAACAAAGGATGAAGCATTACATTACTTTAAGATATATATGGCTGAGGTAGAAAACCAGCTGGAAAGGAAAATCAAACGGTTGAGGTCTGATAGGGGTG

Reverse complement sequence

CACCCCTATCAGACCTCAACCGTTTGATTTTCCTTTCCAGCTGGTTTTCTACCTCAGCCATATATATCTTAAAGTAATGTAATGCTTCATCCTTTGTTTT[T/C]
AATAGGTACACATAGCAGAATCTAGTGCAATCATCTATCAGTGTCATGAAATATTTCTTTCCCCCTTTAGTCTACACGCCATTCATTTCGCACAGATCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 10.30% 1.21% 39.61% NA
All Indica  2759 27.70% 7.10% 1.34% 63.86% NA
All Japonica  1512 94.90% 0.90% 0.93% 3.31% NA
Aus  269 21.20% 76.60% 0.00% 2.23% NA
Indica I  595 16.50% 17.60% 1.01% 64.87% NA
Indica II  465 24.90% 1.70% 1.51% 71.83% NA
Indica III  913 33.20% 5.00% 0.99% 60.79% NA
Indica Intermediate  786 31.30% 4.80% 1.91% 61.96% NA
Temperate Japonica  767 98.70% 0.10% 0.26% 0.91% NA
Tropical Japonica  504 94.40% 1.20% 0.99% 3.37% NA
Japonica Intermediate  241 83.80% 2.50% 2.90% 10.79% NA
VI/Aromatic  96 9.40% 63.50% 3.12% 23.96% NA
Intermediate  90 51.10% 11.10% 3.33% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016355947 A -> G LOC_Os10g31200.1 upstream_gene_variant ; 349.0bp to feature; MODIFIER silent_mutation Average:24.178; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg1016355947 A -> G LOC_Os10g31189.1 downstream_gene_variant ; 72.0bp to feature; MODIFIER silent_mutation Average:24.178; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg1016355947 A -> G LOC_Os10g31189-LOC_Os10g31200 intergenic_region ; MODIFIER silent_mutation Average:24.178; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg1016355947 A -> DEL N N silent_mutation Average:24.178; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016355947 4.86E-06 NA Plant_height Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1016355947 NA 3.73E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016355947 NA 2.22E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016355947 NA 5.08E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016355947 NA 6.51E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251