\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016225510:

Variant ID: vg1016225510 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16225510
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCTAGCTCCACCAGCCATTTCTCCCCCCCATCTCCTCTCTGCTTGCGAGCTTGTCAACCGCGCAAAGGTTCATATATACACCGATCGAAATCGATCGG[T/A]
GTAGAGCCACACTCTTGGAGTCGATCGTTCGCTGGTTAGCTAACTAAGCTAAGCTGAGCTGCCTTGCTCTCTTCGACGATCAGGTTGCTTGGTTTGACGA

Reverse complement sequence

TCGTCAAACCAAGCAACCTGATCGTCGAAGAGAGCAAGGCAGCTCAGCTTAGCTTAGTTAGCTAACCAGCGAACGATCGACTCCAAGAGTGTGGCTCTAC[A/T]
CCGATCGATTTCGATCGGTGTATATATGAACCTTTGCGCGGTTGACAAGCTCGCAAGCAGAGAGGAGATGGGGGGGAGAAATGGCTGGTGGAGCTAGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.50% 0.02% 0.34% NA
All Indica  2759 99.20% 0.20% 0.00% 0.58% NA
All Japonica  1512 86.30% 13.60% 0.07% 0.00% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.20% 0.00% 0.00% 1.75% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 90.50% 9.40% 0.13% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016225510 T -> A LOC_Os10g31040.1 5_prime_UTR_variant ; 10150.0bp to feature; MODIFIER silent_mutation Average:79.087; most accessible tissue: Callus, score: 95.414 N N N N
vg1016225510 T -> A LOC_Os10g31040.5 5_prime_UTR_variant ; 10150.0bp to feature; MODIFIER silent_mutation Average:79.087; most accessible tissue: Callus, score: 95.414 N N N N
vg1016225510 T -> DEL N N silent_mutation Average:79.087; most accessible tissue: Callus, score: 95.414 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016225510 8.86E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 4.09E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 4.84E-06 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 6.11E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 2.61E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 1.17E-06 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 8.19E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 1.13E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 2.17E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 4.99E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 4.77E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 1.25E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 2.37E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 1.29E-06 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 1.47E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 5.37E-07 NA mr1961_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016225510 NA 2.22E-06 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251