\
| Variant ID: vg1016225510 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16225510 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 263. )
CCTCTAGCTCCACCAGCCATTTCTCCCCCCCATCTCCTCTCTGCTTGCGAGCTTGTCAACCGCGCAAAGGTTCATATATACACCGATCGAAATCGATCGG[T/A]
GTAGAGCCACACTCTTGGAGTCGATCGTTCGCTGGTTAGCTAACTAAGCTAAGCTGAGCTGCCTTGCTCTCTTCGACGATCAGGTTGCTTGGTTTGACGA
TCGTCAAACCAAGCAACCTGATCGTCGAAGAGAGCAAGGCAGCTCAGCTTAGCTTAGTTAGCTAACCAGCGAACGATCGACTCCAAGAGTGTGGCTCTAC[A/T]
CCGATCGATTTCGATCGGTGTATATATGAACCTTTGCGCGGTTGACAAGCTCGCAAGCAGAGAGGAGATGGGGGGGAGAAATGGCTGGTGGAGCTAGAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.50% | 0.02% | 0.34% | NA |
| All Indica | 2759 | 99.20% | 0.20% | 0.00% | 0.58% | NA |
| All Japonica | 1512 | 86.30% | 13.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 0.00% | 0.00% | 1.75% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.50% | 9.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.00% | 44.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016225510 | T -> A | LOC_Os10g31040.1 | 5_prime_UTR_variant ; 10150.0bp to feature; MODIFIER | silent_mutation | Average:79.087; most accessible tissue: Callus, score: 95.414 | N | N | N | N |
| vg1016225510 | T -> A | LOC_Os10g31040.5 | 5_prime_UTR_variant ; 10150.0bp to feature; MODIFIER | silent_mutation | Average:79.087; most accessible tissue: Callus, score: 95.414 | N | N | N | N |
| vg1016225510 | T -> DEL | N | N | silent_mutation | Average:79.087; most accessible tissue: Callus, score: 95.414 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016225510 | 8.86E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 4.09E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 4.84E-06 | NA | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 6.11E-06 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 2.61E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 1.17E-06 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 8.19E-06 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 1.13E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 2.17E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 4.99E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 4.77E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 1.25E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 2.37E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 1.29E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 1.47E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | 5.37E-07 | NA | mr1961_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016225510 | NA | 2.22E-06 | mr1961_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |