Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016195645:

Variant ID: vg1016195645 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16195645
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AACTAGCATGAACGCATCATTAGATCTACACATGTAAACTACACAGTATAACATGAACAGATCAAATATGCGCAACATATTGAACATGTACCGAGGTGGC[A/G]
AAAAGACCGGCTGCTCGGTCGAAACTTTTCGCAGGCGTCTACAAAGGCACGCAACACGCGAGCGAAGAGGAAGACGAGCCGTCGCGGACGAACAGGGAGC

Reverse complement sequence

GCTCCCTGTTCGTCCGCGACGGCTCGTCTTCCTCTTCGCTCGCGTGTTGCGTGCCTTTGTAGACGCCTGCGAAAAGTTTCGACCGAGCAGCCGGTCTTTT[T/C]
GCCACCTCGGTACATGTTCAATATGTTGCGCATATTTGATCTGTTCATGTTATACTGTGTAGTTTACATGTGTAGATCTAATGATGCGTTCATGCTAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.80%	2.90%	25.62%	49.62%	NA
All Indica	2759	2.20%	3.30%	27.40%	67.05%	NA
All Japonica	1512	61.40%	2.00%	14.22%	22.42%	NA
Aus	269	6.70%	3.70%	54.28%	35.32%	NA
Indica I	595	1.50%	2.50%	15.13%	80.84%	NA
Indica II	465	2.80%	3.90%	21.29%	72.04%	NA
Indica III	913	1.50%	4.10%	38.66%	55.75%	NA
Indica Intermediate	786	3.20%	2.80%	27.23%	66.79%	NA
Temperate Japonica	767	96.50%	0.10%	1.96%	1.43%	NA
Tropical Japonica	504	7.10%	4.80%	32.94%	55.16%	NA
Japonica Intermediate	241	63.10%	2.10%	14.11%	20.75%	NA
VI/Aromatic	96	2.10%	4.20%	72.92%	20.83%	NA
Intermediate	90	25.60%	2.20%	26.67%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016195645	A -> G	LOC_Os10g31020.1	upstream_gene_variant ; 203.0bp to feature; MODIFIER	silent_mutation	Average:15.781; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg1016195645	A -> G	LOC_Os10g31020-LOC_Os10g31030	intergenic_region ; MODIFIER	silent_mutation	Average:15.781; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg1016195645	A -> DEL	N	N	silent_mutation	Average:15.781; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016195645	NA	1.75E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	3.36E-10	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	2.12E-08	mr1271	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	1.18E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	9.52E-15	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	1.03E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	6.27E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	5.88E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	1.59E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	6.70E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	2.96E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	1.78E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	5.77E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	8.73E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	4.28E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	4.19E-13	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	8.85E-16	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	3.79E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	1.29E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	1.31E-09	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645	NA	5.76E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251