\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016195645:

Variant ID: vg1016195645 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16195645
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AACTAGCATGAACGCATCATTAGATCTACACATGTAAACTACACAGTATAACATGAACAGATCAAATATGCGCAACATATTGAACATGTACCGAGGTGGC[A/G]
AAAAGACCGGCTGCTCGGTCGAAACTTTTCGCAGGCGTCTACAAAGGCACGCAACACGCGAGCGAAGAGGAAGACGAGCCGTCGCGGACGAACAGGGAGC

Reverse complement sequence

GCTCCCTGTTCGTCCGCGACGGCTCGTCTTCCTCTTCGCTCGCGTGTTGCGTGCCTTTGTAGACGCCTGCGAAAAGTTTCGACCGAGCAGCCGGTCTTTT[T/C]
GCCACCTCGGTACATGTTCAATATGTTGCGCATATTTGATCTGTTCATGTTATACTGTGTAGTTTACATGTGTAGATCTAATGATGCGTTCATGCTAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.80% 2.90% 25.62% 49.62% NA
All Indica  2759 2.20% 3.30% 27.40% 67.05% NA
All Japonica  1512 61.40% 2.00% 14.22% 22.42% NA
Aus  269 6.70% 3.70% 54.28% 35.32% NA
Indica I  595 1.50% 2.50% 15.13% 80.84% NA
Indica II  465 2.80% 3.90% 21.29% 72.04% NA
Indica III  913 1.50% 4.10% 38.66% 55.75% NA
Indica Intermediate  786 3.20% 2.80% 27.23% 66.79% NA
Temperate Japonica  767 96.50% 0.10% 1.96% 1.43% NA
Tropical Japonica  504 7.10% 4.80% 32.94% 55.16% NA
Japonica Intermediate  241 63.10% 2.10% 14.11% 20.75% NA
VI/Aromatic  96 2.10% 4.20% 72.92% 20.83% NA
Intermediate  90 25.60% 2.20% 26.67% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016195645 A -> G LOC_Os10g31020.1 upstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:15.781; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg1016195645 A -> G LOC_Os10g31020-LOC_Os10g31030 intergenic_region ; MODIFIER silent_mutation Average:15.781; most accessible tissue: Minghui63 root, score: 27.443 N N N N
vg1016195645 A -> DEL N N silent_mutation Average:15.781; most accessible tissue: Minghui63 root, score: 27.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016195645 NA 1.75E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 3.36E-10 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 2.12E-08 mr1271 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 1.18E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 9.52E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 1.03E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 6.27E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 5.88E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 1.59E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 6.70E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 2.96E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 1.78E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 5.77E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 8.73E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 4.28E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 4.19E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 8.85E-16 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 3.79E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 1.29E-14 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 1.31E-09 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016195645 NA 5.76E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251