Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1016075640:

Variant ID: vg1016075640 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16075640
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

GACTAATCAATTCTACATTAATGAGTGAATGAATTCCAACAAATTGATTTTGCTGTTAATCACATAATTGAATCGAATTGATTTCGATTTAATTACTCCT[G/A]
AACGTTACTCCCTCACGCACTATATAATCCCACCTACGCGACGGGAAGAGAGACACCCGTTCATCCTCTCACACTATGATTTCTCACTGGTTCCTCTCCG

Reverse complement sequence

CGGAGAGGAACCAGTGAGAAATCATAGTGTGAGAGGATGAACGGGTGTCTCTCTTCCCGTCGCGTAGGTGGGATTATATAGTGCGTGAGGGAGTAACGTT[C/T]
AGGAGTAATTAAATCGAAATCAATTCGATTCAATTATGTGATTAACAGCAAAATCAATTTGTTGGAATTCATTCACTCATTAATGTAGAATTGATTAGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.50%	1.80%	0.68%	0.00%	NA
All Indica	2759	95.90%	3.10%	1.05%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	87.10%	9.60%	3.36%	0.00%	NA
Indica II	465	97.80%	1.50%	0.65%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	2.70%	0.76%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016075640	G -> A	LOC_Os10g30840-LOC_Os10g30850	intergenic_region ; MODIFIER	silent_mutation	Average:61.42; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016075640	5.91E-08	1.59E-14	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	2.15E-06	1.99E-06	mr1281	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	3.16E-06	3.16E-06	mr1288	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	7.47E-08	1.05E-07	mr1344	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	1.88E-07	1.16E-15	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	4.15E-06	2.03E-07	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	NA	4.91E-07	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	NA	6.38E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	NA	2.94E-06	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	NA	4.83E-06	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	NA	7.68E-11	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016075640	NA	3.25E-10	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251