\
| Variant ID: vg1016075640 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16075640 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )
GACTAATCAATTCTACATTAATGAGTGAATGAATTCCAACAAATTGATTTTGCTGTTAATCACATAATTGAATCGAATTGATTTCGATTTAATTACTCCT[G/A]
AACGTTACTCCCTCACGCACTATATAATCCCACCTACGCGACGGGAAGAGAGACACCCGTTCATCCTCTCACACTATGATTTCTCACTGGTTCCTCTCCG
CGGAGAGGAACCAGTGAGAAATCATAGTGTGAGAGGATGAACGGGTGTCTCTCTTCCCGTCGCGTAGGTGGGATTATATAGTGCGTGAGGGAGTAACGTT[C/T]
AGGAGTAATTAAATCGAAATCAATTCGATTCAATTATGTGATTAACAGCAAAATCAATTTGTTGGAATTCATTCACTCATTAATGTAGAATTGATTAGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.80% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 3.10% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.10% | 9.60% | 3.36% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016075640 | G -> A | LOC_Os10g30840-LOC_Os10g30850 | intergenic_region ; MODIFIER | silent_mutation | Average:61.42; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016075640 | 5.91E-08 | 1.59E-14 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | 2.15E-06 | 1.99E-06 | mr1281 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | 3.16E-06 | 3.16E-06 | mr1288 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | 7.47E-08 | 1.05E-07 | mr1344 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | 1.88E-07 | 1.16E-15 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | 4.15E-06 | 2.03E-07 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | NA | 4.91E-07 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | NA | 6.38E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | NA | 2.94E-06 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | NA | 4.83E-06 | mr1982 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | NA | 7.68E-11 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016075640 | NA | 3.25E-10 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |