\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015983381:

Variant ID: vg1015983381 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15983381
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGATTTTATTTTTCGGTCTGTTTAAAATTGCAGTACTTTCGTGTTGATGATTCCTTCTTTCGTCAATAAATAGGATTCAGAGCTACTACATTGAGTTC[A/G]
GCAAAGGTATATGTGTTGCAAATTACACTATGTCTCTAAACATTTTCTAAGTTACATGGTGAAACTATTATTAAGATATCTATATCATATCATACTGTTA

Reverse complement sequence

TAACAGTATGATATGATATAGATATCTTAATAATAGTTTCACCATGTAACTTAGAAAATGTTTAGAGACATAGTGTAATTTGCAACACATATACCTTTGC[T/C]
GAACTCAATGTAGTAGCTCTGAATCCTATTTATTGACGAAAGAAGGAATCATCAACACGAAAGTACTGCAATTTTAAACAGACCGAAAAATAAAATCCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 3.80% 4.87% 42.02% NA
All Indica  2759 19.00% 5.00% 6.67% 69.41% NA
All Japonica  1512 99.50% 0.00% 0.20% 0.26% NA
Aus  269 68.00% 8.20% 10.04% 13.75% NA
Indica I  595 12.10% 0.20% 8.40% 79.33% NA
Indica II  465 21.90% 11.60% 5.81% 60.65% NA
Indica III  913 12.40% 3.10% 6.24% 78.31% NA
Indica Intermediate  786 30.00% 6.90% 6.36% 56.74% NA
Temperate Japonica  767 99.20% 0.00% 0.39% 0.39% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 53.10% 20.80% 13.54% 12.50% NA
Intermediate  90 74.40% 2.20% 3.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015983381 A -> G LOC_Os10g30680.1 upstream_gene_variant ; 2856.0bp to feature; MODIFIER silent_mutation Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1015983381 A -> G LOC_Os10g30690.1 upstream_gene_variant ; 415.0bp to feature; MODIFIER silent_mutation Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1015983381 A -> G LOC_Os10g30680-LOC_Os10g30690 intergenic_region ; MODIFIER silent_mutation Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1015983381 A -> DEL N N silent_mutation Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015983381 2.67E-14 3.90E-15 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 5.06E-09 5.55E-10 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 7.03E-06 5.32E-07 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 5.00E-06 3.79E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 5.28E-07 4.23E-09 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 2.90E-07 3.05E-09 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 4.59E-08 2.18E-10 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 NA 9.19E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381 6.71E-06 6.71E-06 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251