\
| Variant ID: vg1015983381 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15983381 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 109. )
TGGGATTTTATTTTTCGGTCTGTTTAAAATTGCAGTACTTTCGTGTTGATGATTCCTTCTTTCGTCAATAAATAGGATTCAGAGCTACTACATTGAGTTC[A/G]
GCAAAGGTATATGTGTTGCAAATTACACTATGTCTCTAAACATTTTCTAAGTTACATGGTGAAACTATTATTAAGATATCTATATCATATCATACTGTTA
TAACAGTATGATATGATATAGATATCTTAATAATAGTTTCACCATGTAACTTAGAAAATGTTTAGAGACATAGTGTAATTTGCAACACATATACCTTTGC[T/C]
GAACTCAATGTAGTAGCTCTGAATCCTATTTATTGACGAAAGAAGGAATCATCAACACGAAAGTACTGCAATTTTAAACAGACCGAAAAATAAAATCCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 3.80% | 4.87% | 42.02% | NA |
| All Indica | 2759 | 19.00% | 5.00% | 6.67% | 69.41% | NA |
| All Japonica | 1512 | 99.50% | 0.00% | 0.20% | 0.26% | NA |
| Aus | 269 | 68.00% | 8.20% | 10.04% | 13.75% | NA |
| Indica I | 595 | 12.10% | 0.20% | 8.40% | 79.33% | NA |
| Indica II | 465 | 21.90% | 11.60% | 5.81% | 60.65% | NA |
| Indica III | 913 | 12.40% | 3.10% | 6.24% | 78.31% | NA |
| Indica Intermediate | 786 | 30.00% | 6.90% | 6.36% | 56.74% | NA |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.39% | 0.39% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 20.80% | 13.54% | 12.50% | NA |
| Intermediate | 90 | 74.40% | 2.20% | 3.33% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015983381 | A -> G | LOC_Os10g30680.1 | upstream_gene_variant ; 2856.0bp to feature; MODIFIER | silent_mutation | Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1015983381 | A -> G | LOC_Os10g30690.1 | upstream_gene_variant ; 415.0bp to feature; MODIFIER | silent_mutation | Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1015983381 | A -> G | LOC_Os10g30680-LOC_Os10g30690 | intergenic_region ; MODIFIER | silent_mutation | Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1015983381 | A -> DEL | N | N | silent_mutation | Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015983381 | 2.67E-14 | 3.90E-15 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | 5.06E-09 | 5.55E-10 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | 7.03E-06 | 5.32E-07 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | 5.00E-06 | 3.79E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | 5.28E-07 | 4.23E-09 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | 2.90E-07 | 3.05E-09 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | 4.59E-08 | 2.18E-10 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | NA | 9.19E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015983381 | 6.71E-06 | 6.71E-06 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |