\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015917537:

Variant ID: vg1015917537 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15917537
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTCTTTTGAGTCCAAAATAGGAGAGATTCTTAGGCCCTGTTTAGTTACAGGGGTGAAAGGTTTTGGCGTGTCACATTGGATATACGGGCACACATTT[G/A]
AAGTATTAAACGTAGACTAATAACAAAACAGATTACATATTCTACCTATAAACTACGAGACAAATTTATTAAGCCTAATTAATCCGTCATTAGCAAAATG

Reverse complement sequence

CATTTTGCTAATGACGGATTAATTAGGCTTAATAAATTTGTCTCGTAGTTTATAGGTAGAATATGTAATCTGTTTTGTTATTAGTCTACGTTTAATACTT[C/T]
AAATGTGTGCCCGTATATCCAATGTGACACGCCAAAACCTTTCACCCCTGTAACTAAACAGGGCCTAAGAATCTCTCCTATTTTGGACTCAAAAGAATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 1.80% 1.52% 5.37% NA
All Indica  2759 99.70% 0.10% 0.04% 0.07% NA
All Japonica  1512 75.80% 3.40% 4.63% 16.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.00% 0.25% NA
Temperate Japonica  767 90.70% 0.00% 0.65% 8.60% NA
Tropical Japonica  504 67.30% 9.50% 9.52% 13.69% NA
Japonica Intermediate  241 46.10% 1.20% 7.05% 45.64% NA
VI/Aromatic  96 72.90% 25.00% 0.00% 2.08% NA
Intermediate  90 86.70% 6.70% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015917537 G -> A LOC_Os10g30590.1 upstream_gene_variant ; 706.0bp to feature; MODIFIER silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1015917537 G -> A LOC_Os10g30590.2 upstream_gene_variant ; 706.0bp to feature; MODIFIER silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1015917537 G -> A LOC_Os10g30580.1 downstream_gene_variant ; 1567.0bp to feature; MODIFIER silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1015917537 G -> A LOC_Os10g30600.1 downstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1015917537 G -> A LOC_Os10g30580.2 downstream_gene_variant ; 1617.0bp to feature; MODIFIER silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1015917537 G -> A LOC_Os10g30600.2 downstream_gene_variant ; 3592.0bp to feature; MODIFIER silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1015917537 G -> A LOC_Os10g30580-LOC_Os10g30590 intergenic_region ; MODIFIER silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1015917537 G -> DEL N N silent_mutation Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015917537 NA 1.77E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 3.57E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 1.60E-06 1.31E-07 mr1107 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 6.50E-06 2.40E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 2.48E-06 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 8.55E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 3.80E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 1.14E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 1.62E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 3.91E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 8.67E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 4.83E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 8.69E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537 NA 4.22E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251