Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1015917537:

Variant ID: vg1015917537 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15917537
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTCTTTTGAGTCCAAAATAGGAGAGATTCTTAGGCCCTGTTTAGTTACAGGGGTGAAAGGTTTTGGCGTGTCACATTGGATATACGGGCACACATTT[G/A]
AAGTATTAAACGTAGACTAATAACAAAACAGATTACATATTCTACCTATAAACTACGAGACAAATTTATTAAGCCTAATTAATCCGTCATTAGCAAAATG

Reverse complement sequence

CATTTTGCTAATGACGGATTAATTAGGCTTAATAAATTTGTCTCGTAGTTTATAGGTAGAATATGTAATCTGTTTTGTTATTAGTCTACGTTTAATACTT[C/T]
AAATGTGTGCCCGTATATCCAATGTGACACGCCAAAACCTTTCACCCCTGTAACTAAACAGGGCCTAAGAATCTCTCCTATTTTGGACTCAAAAGAATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	1.80%	1.52%	5.37%	NA
All Indica	2759	99.70%	0.10%	0.04%	0.07%	NA
All Japonica	1512	75.80%	3.40%	4.63%	16.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.40%	0.00%	0.25%	NA
Temperate Japonica	767	90.70%	0.00%	0.65%	8.60%	NA
Tropical Japonica	504	67.30%	9.50%	9.52%	13.69%	NA
Japonica Intermediate	241	46.10%	1.20%	7.05%	45.64%	NA
VI/Aromatic	96	72.90%	25.00%	0.00%	2.08%	NA
Intermediate	90	86.70%	6.70%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015917537	G -> A	LOC_Os10g30590.1	upstream_gene_variant ; 706.0bp to feature; MODIFIER	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1015917537	G -> A	LOC_Os10g30590.2	upstream_gene_variant ; 706.0bp to feature; MODIFIER	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1015917537	G -> A	LOC_Os10g30580.1	downstream_gene_variant ; 1567.0bp to feature; MODIFIER	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1015917537	G -> A	LOC_Os10g30600.1	downstream_gene_variant ; 3298.0bp to feature; MODIFIER	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1015917537	G -> A	LOC_Os10g30580.2	downstream_gene_variant ; 1617.0bp to feature; MODIFIER	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1015917537	G -> A	LOC_Os10g30600.2	downstream_gene_variant ; 3592.0bp to feature; MODIFIER	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1015917537	G -> A	LOC_Os10g30580-LOC_Os10g30590	intergenic_region ; MODIFIER	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg1015917537	G -> DEL	N	N	silent_mutation	Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015917537	NA	1.77E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	3.57E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	1.60E-06	1.31E-07	mr1107	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	6.50E-06	2.40E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	2.48E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	8.55E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	3.80E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	1.14E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	1.62E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	3.91E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	8.67E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	4.83E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	8.69E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015917537	NA	4.22E-08	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251