\
| Variant ID: vg1015917537 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15917537 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTATTCTTTTGAGTCCAAAATAGGAGAGATTCTTAGGCCCTGTTTAGTTACAGGGGTGAAAGGTTTTGGCGTGTCACATTGGATATACGGGCACACATTT[G/A]
AAGTATTAAACGTAGACTAATAACAAAACAGATTACATATTCTACCTATAAACTACGAGACAAATTTATTAAGCCTAATTAATCCGTCATTAGCAAAATG
CATTTTGCTAATGACGGATTAATTAGGCTTAATAAATTTGTCTCGTAGTTTATAGGTAGAATATGTAATCTGTTTTGTTATTAGTCTACGTTTAATACTT[C/T]
AAATGTGTGCCCGTATATCCAATGTGACACGCCAAAACCTTTCACCCCTGTAACTAAACAGGGCCTAAGAATCTCTCCTATTTTGGACTCAAAAGAATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 1.80% | 1.52% | 5.37% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.04% | 0.07% | NA |
| All Japonica | 1512 | 75.80% | 3.40% | 4.63% | 16.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 90.70% | 0.00% | 0.65% | 8.60% | NA |
| Tropical Japonica | 504 | 67.30% | 9.50% | 9.52% | 13.69% | NA |
| Japonica Intermediate | 241 | 46.10% | 1.20% | 7.05% | 45.64% | NA |
| VI/Aromatic | 96 | 72.90% | 25.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 86.70% | 6.70% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015917537 | G -> A | LOC_Os10g30590.1 | upstream_gene_variant ; 706.0bp to feature; MODIFIER | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1015917537 | G -> A | LOC_Os10g30590.2 | upstream_gene_variant ; 706.0bp to feature; MODIFIER | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1015917537 | G -> A | LOC_Os10g30580.1 | downstream_gene_variant ; 1567.0bp to feature; MODIFIER | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1015917537 | G -> A | LOC_Os10g30600.1 | downstream_gene_variant ; 3298.0bp to feature; MODIFIER | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1015917537 | G -> A | LOC_Os10g30580.2 | downstream_gene_variant ; 1617.0bp to feature; MODIFIER | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1015917537 | G -> A | LOC_Os10g30600.2 | downstream_gene_variant ; 3592.0bp to feature; MODIFIER | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1015917537 | G -> A | LOC_Os10g30580-LOC_Os10g30590 | intergenic_region ; MODIFIER | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1015917537 | G -> DEL | N | N | silent_mutation | Average:62.929; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015917537 | NA | 1.77E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 3.57E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | 1.60E-06 | 1.31E-07 | mr1107 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | 6.50E-06 | 2.40E-08 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 2.48E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 8.55E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 3.80E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 1.14E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 1.62E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 3.91E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 8.67E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 4.83E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 8.69E-06 | mr1782_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015917537 | NA | 4.22E-08 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |