\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015840569:

Variant ID: vg1015840569 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 15840569
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TATACCGCAACCCACCCAACAACCGAACCGACCACTTCTCCCCATCCTCTTCTCTTTTTCTAGCGAGACGCGTCCACCTCCTCTGCCCGCCCGTCGCCGG[C/T]
GCGAGTCTCCGCCCCTCCTCCCGTTGTTTTCTCTCCCCCCGCCCGTCGCCATCCACCACACCGGTAGCCGGCCCTGTCCCGCTACCGCTGCCAATATCCC

Reverse complement sequence

GGGATATTGGCAGCGGTAGCGGGACAGGGCCGGCTACCGGTGTGGTGGATGGCGACGGGCGGGGGGAGAGAAAACAACGGGAGGAGGGGCGGAGACTCGC[G/A]
CCGGCGACGGGCGGGCAGAGGAGGTGGACGCGTCTCGCTAGAAAAAGAGAAGAGGATGGGGAGAAGTGGTCGGTTCGGTTGTTGGGTGGGTTGCGGTATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.40% 24.70% 1.52% 13.46% NA
All Indica  2759 88.00% 4.60% 1.88% 5.44% NA
All Japonica  1512 3.80% 65.60% 1.06% 29.56% NA
Aus  269 94.10% 5.20% 0.00% 0.74% NA
Indica I  595 81.30% 13.90% 2.18% 2.52% NA
Indica II  465 85.60% 2.20% 3.87% 8.39% NA
Indica III  913 94.30% 0.00% 0.33% 5.37% NA
Indica Intermediate  786 87.30% 4.50% 2.29% 5.98% NA
Temperate Japonica  767 1.20% 96.20% 0.13% 2.48% NA
Tropical Japonica  504 4.80% 17.10% 1.59% 76.59% NA
Japonica Intermediate  241 10.00% 69.70% 2.90% 17.43% NA
VI/Aromatic  96 71.90% 3.10% 3.12% 21.88% NA
Intermediate  90 50.00% 31.10% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015840569 C -> T LOC_Os10g30460-LOC_Os10g30480 intergenic_region ; MODIFIER silent_mutation Average:82.086; most accessible tissue: Minghui63 root, score: 90.418 N N N N
vg1015840569 C -> DEL N N silent_mutation Average:82.086; most accessible tissue: Minghui63 root, score: 90.418 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1015840569 C T 0.01 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015840569 2.23E-06 NA mr1008 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 1.39E-06 NA mr1009 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 9.92E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 1.73E-06 NA mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 7.17E-06 NA mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 2.43E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 7.89E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 1.42E-11 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 5.75E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 3.02E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 7.97E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 6.20E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 1.13E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015840569 NA 1.36E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251