\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015833251:

Variant ID: vg1015833251 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 15833251
Reference Allele: CAlternative Allele: CGGCGCA,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGAGTGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGTTAGAGGGGGTTATGCGAAGGGTCCTGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATAT[C/CGGCGCA,T]
GGCGCACGGAAACATGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACACCTCTGATCAGAGTAAAACTATTCGAATAGCCTTGCCCGCGGTTATGGGC

Reverse complement sequence

GCCCATAACCGCGGGCAAGGCTATTCGAATAGTTTTACTCTGATCAGAGGTGTACAACTGTACCCACAAGACACAGCCCCACGACATGTTTCCGTGCGCC[G/TGCGCCG,A]
ATATGCCACCACGACATACCGGAAAGAGGCCGTGACAGGACCCTTCGCATAACCCCCTCTAACCAAGCACACCACACCTCAGGTTTCACCCCCACTCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 2.90% 14.18% 10.09% CGGCGCA: 1.27%
All Indica  2759 74.30% 0.00% 16.71% 8.34% CGGCGCA: 0.65%
All Japonica  1512 68.90% 8.90% 6.75% 15.21% CGGCGCA: 0.20%
Aus  269 62.10% 0.00% 24.16% 0.74% CGGCGCA: 13.01%
Indica I  595 76.00% 0.00% 21.85% 1.34% CGGCGCA: 0.84%
Indica II  465 71.60% 0.00% 19.78% 8.39% CGGCGCA: 0.22%
Indica III  913 69.90% 0.00% 15.01% 14.35% CGGCGCA: 0.77%
Indica Intermediate  786 79.60% 0.10% 12.98% 6.62% CGGCGCA: 0.64%
Temperate Japonica  767 89.00% 5.50% 3.65% 1.83% NA
Tropical Japonica  504 49.80% 5.20% 6.35% 38.29% CGGCGCA: 0.40%
Japonica Intermediate  241 44.80% 27.80% 17.43% 9.54% CGGCGCA: 0.41%
VI/Aromatic  96 50.00% 2.10% 37.50% 8.33% CGGCGCA: 2.08%
Intermediate  90 82.20% 1.10% 6.67% 7.78% CGGCGCA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1015833251 C -> CGGCGCA LOC_Os10g30460.1 upstream_gene_variant ; 1408.0bp to feature; MODIFIER silent_mutation Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1015833251 C -> CGGCGCA LOC_Os10g30450.1 downstream_gene_variant ; 4426.0bp to feature; MODIFIER silent_mutation Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1015833251 C -> CGGCGCA LOC_Os10g30460-LOC_Os10g30480 intergenic_region ; MODIFIER silent_mutation Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1015833251 C -> T LOC_Os10g30460.1 upstream_gene_variant ; 1407.0bp to feature; MODIFIER silent_mutation Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1015833251 C -> T LOC_Os10g30450.1 downstream_gene_variant ; 4425.0bp to feature; MODIFIER silent_mutation Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1015833251 C -> T LOC_Os10g30460-LOC_Os10g30480 intergenic_region ; MODIFIER silent_mutation Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1015833251 C -> DEL N N silent_mutation Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1015833251 NA 2.63E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251 NA 1.71E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251 NA 2.91E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251 2.12E-07 2.60E-08 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251 NA 1.62E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251 NA 1.11E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251 NA 1.16E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251