\
| Variant ID: vg1015833251 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 15833251 |
| Reference Allele: C | Alternative Allele: CGGCGCA,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGGAGTGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGTTAGAGGGGGTTATGCGAAGGGTCCTGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATAT[C/CGGCGCA,T]
GGCGCACGGAAACATGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACACCTCTGATCAGAGTAAAACTATTCGAATAGCCTTGCCCGCGGTTATGGGC
GCCCATAACCGCGGGCAAGGCTATTCGAATAGTTTTACTCTGATCAGAGGTGTACAACTGTACCCACAAGACACAGCCCCACGACATGTTTCCGTGCGCC[G/TGCGCCG,A]
ATATGCCACCACGACATACCGGAAAGAGGCCGTGACAGGACCCTTCGCATAACCCCCTCTAACCAAGCACACCACACCTCAGGTTTCACCCCCACTCCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 2.90% | 14.18% | 10.09% | CGGCGCA: 1.27% |
| All Indica | 2759 | 74.30% | 0.00% | 16.71% | 8.34% | CGGCGCA: 0.65% |
| All Japonica | 1512 | 68.90% | 8.90% | 6.75% | 15.21% | CGGCGCA: 0.20% |
| Aus | 269 | 62.10% | 0.00% | 24.16% | 0.74% | CGGCGCA: 13.01% |
| Indica I | 595 | 76.00% | 0.00% | 21.85% | 1.34% | CGGCGCA: 0.84% |
| Indica II | 465 | 71.60% | 0.00% | 19.78% | 8.39% | CGGCGCA: 0.22% |
| Indica III | 913 | 69.90% | 0.00% | 15.01% | 14.35% | CGGCGCA: 0.77% |
| Indica Intermediate | 786 | 79.60% | 0.10% | 12.98% | 6.62% | CGGCGCA: 0.64% |
| Temperate Japonica | 767 | 89.00% | 5.50% | 3.65% | 1.83% | NA |
| Tropical Japonica | 504 | 49.80% | 5.20% | 6.35% | 38.29% | CGGCGCA: 0.40% |
| Japonica Intermediate | 241 | 44.80% | 27.80% | 17.43% | 9.54% | CGGCGCA: 0.41% |
| VI/Aromatic | 96 | 50.00% | 2.10% | 37.50% | 8.33% | CGGCGCA: 2.08% |
| Intermediate | 90 | 82.20% | 1.10% | 6.67% | 7.78% | CGGCGCA: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015833251 | C -> CGGCGCA | LOC_Os10g30460.1 | upstream_gene_variant ; 1408.0bp to feature; MODIFIER | silent_mutation | Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1015833251 | C -> CGGCGCA | LOC_Os10g30450.1 | downstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1015833251 | C -> CGGCGCA | LOC_Os10g30460-LOC_Os10g30480 | intergenic_region ; MODIFIER | silent_mutation | Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1015833251 | C -> T | LOC_Os10g30460.1 | upstream_gene_variant ; 1407.0bp to feature; MODIFIER | silent_mutation | Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1015833251 | C -> T | LOC_Os10g30450.1 | downstream_gene_variant ; 4425.0bp to feature; MODIFIER | silent_mutation | Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1015833251 | C -> T | LOC_Os10g30460-LOC_Os10g30480 | intergenic_region ; MODIFIER | silent_mutation | Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1015833251 | C -> DEL | N | N | silent_mutation | Average:30.598; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015833251 | NA | 2.63E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015833251 | NA | 1.71E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015833251 | NA | 2.91E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015833251 | 2.12E-07 | 2.60E-08 | mr1936 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015833251 | NA | 1.62E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015833251 | NA | 1.11E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015833251 | NA | 1.16E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |