Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1015833251:

Variant ID: vg1015833251 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 15833251
Reference Allele: C	Alternative Allele: CGGCGCA,T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGGAGTGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGTTAGAGGGGGTTATGCGAAGGGTCCTGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATAT[C/CGGCGCA,T]
GGCGCACGGAAACATGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACACCTCTGATCAGAGTAAAACTATTCGAATAGCCTTGCCCGCGGTTATGGGC

Reverse complement sequence

GCCCATAACCGCGGGCAAGGCTATTCGAATAGTTTTACTCTGATCAGAGGTGTACAACTGTACCCACAAGACACAGCCCCACGACATGTTTCCGTGCGCC[G/TGCGCCG,A]
ATATGCCACCACGACATACCGGAAAGAGGCCGTGACAGGACCCTTCGCATAACCCCCTCTAACCAAGCACACCACACCTCAGGTTTCACCCCCACTCCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.50%	2.90%	14.18%	10.09%	CGGCGCA: 1.27%
All Indica	2759	74.30%	0.00%	16.71%	8.34%	CGGCGCA: 0.65%
All Japonica	1512	68.90%	8.90%	6.75%	15.21%	CGGCGCA: 0.20%
Aus	269	62.10%	0.00%	24.16%	0.74%	CGGCGCA: 13.01%
Indica I	595	76.00%	0.00%	21.85%	1.34%	CGGCGCA: 0.84%
Indica II	465	71.60%	0.00%	19.78%	8.39%	CGGCGCA: 0.22%
Indica III	913	69.90%	0.00%	15.01%	14.35%	CGGCGCA: 0.77%
Indica Intermediate	786	79.60%	0.10%	12.98%	6.62%	CGGCGCA: 0.64%
Temperate Japonica	767	89.00%	5.50%	3.65%	1.83%	NA
Tropical Japonica	504	49.80%	5.20%	6.35%	38.29%	CGGCGCA: 0.40%
Japonica Intermediate	241	44.80%	27.80%	17.43%	9.54%	CGGCGCA: 0.41%
VI/Aromatic	96	50.00%	2.10%	37.50%	8.33%	CGGCGCA: 2.08%
Intermediate	90	82.20%	1.10%	6.67%	7.78%	CGGCGCA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015833251	C -> CGGCGCA	LOC_Os10g30460.1	upstream_gene_variant ; 1408.0bp to feature; MODIFIER	silent_mutation	Average:30.598; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1015833251	C -> CGGCGCA	LOC_Os10g30450.1	downstream_gene_variant ; 4426.0bp to feature; MODIFIER	silent_mutation	Average:30.598; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1015833251	C -> CGGCGCA	LOC_Os10g30460-LOC_Os10g30480	intergenic_region ; MODIFIER	silent_mutation	Average:30.598; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1015833251	C -> T	LOC_Os10g30460.1	upstream_gene_variant ; 1407.0bp to feature; MODIFIER	silent_mutation	Average:30.598; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1015833251	C -> T	LOC_Os10g30450.1	downstream_gene_variant ; 4425.0bp to feature; MODIFIER	silent_mutation	Average:30.598; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1015833251	C -> T	LOC_Os10g30460-LOC_Os10g30480	intergenic_region ; MODIFIER	silent_mutation	Average:30.598; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1015833251	C -> DEL	N	N	silent_mutation	Average:30.598; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015833251	NA	2.63E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251	NA	1.71E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251	NA	2.91E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251	2.12E-07	2.60E-08	mr1936	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251	NA	1.62E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251	NA	1.11E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015833251	NA	1.16E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251