Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1015203758:

Variant ID: vg1015203758 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 15203758
Reference Allele: C	Alternative Allele: CAA
Primary Allele: C	Secondary Allele: CAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTATAACAATCATACCTTGTTACTATGATTCGGCTGTAACATTATCCCAGAAGGGTAGTAACATTATATGTTACTGCAAAAATGTATAGGTTGTTACTG[C/CAA]
ACTTTTTACAGTAACAATATGATGAAATTTGCAGTAACAGAGAACATGCATAGTAACAGTGGCCCTATAGTAGTAATGTTTTTTAGATCTAGAGTATTTT

Reverse complement sequence

AAAATACTCTAGATCTAAAAAACATTACTACTATAGGGCCACTGTTACTATGCATGTTCTCTGTTACTGCAAATTTCATCATATTGTTACTGTAAAAAGT[G/TTG]
CAGTAACAACCTATACATTTTTGCAGTAACATATAATGTTACTACCCTTCTGGGATAATGTTACAGCCGAATCATAGTAACAAGGTATGATTGTTATAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of CAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.60%	0.50%	10.75%	48.20%	NA
All Indica	2759	10.80%	0.70%	10.58%	77.96%	NA
All Japonica	1512	97.00%	0.00%	0.26%	2.78%	NA
Aus	269	5.60%	1.10%	71.75%	21.56%	NA
Indica I	595	18.70%	0.20%	13.78%	67.39%	NA
Indica II	465	12.90%	0.00%	8.60%	78.49%	NA
Indica III	913	4.60%	1.20%	11.39%	82.80%	NA
Indica Intermediate	786	10.70%	0.90%	8.40%	80.03%	NA
Temperate Japonica	767	97.40%	0.00%	0.00%	2.61%	NA
Tropical Japonica	504	97.80%	0.00%	0.40%	1.79%	NA
Japonica Intermediate	241	93.80%	0.00%	0.83%	5.39%	NA
VI/Aromatic	96	88.50%	0.00%	10.42%	1.04%	NA
Intermediate	90	61.10%	0.00%	10.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015203758	C -> CAA	LOC_Os10g29190.1	upstream_gene_variant ; 1305.0bp to feature; MODIFIER	silent_mutation	Average:18.497; most accessible tissue: Callus, score: 46.392	N	N	N	N
vg1015203758	C -> CAA	LOC_Os10g29180.1	downstream_gene_variant ; 1595.0bp to feature; MODIFIER	silent_mutation	Average:18.497; most accessible tissue: Callus, score: 46.392	N	N	N	N
vg1015203758	C -> CAA	LOC_Os10g29180.2	downstream_gene_variant ; 2910.0bp to feature; MODIFIER	silent_mutation	Average:18.497; most accessible tissue: Callus, score: 46.392	N	N	N	N
vg1015203758	C -> CAA	LOC_Os10g29180-LOC_Os10g29190	intergenic_region ; MODIFIER	silent_mutation	Average:18.497; most accessible tissue: Callus, score: 46.392	N	N	N	N
vg1015203758	C -> DEL	N	N	silent_mutation	Average:18.497; most accessible tissue: Callus, score: 46.392	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015203758	5.44E-06	NA	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015203758	1.88E-06	NA	mr1059	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015203758	8.20E-06	NA	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015203758	3.36E-06	NA	mr1167_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015203758	3.81E-07	NA	mr1950_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015203758	1.83E-07	3.92E-06	mr1950_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251