Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015182556:

Variant ID: vg1015182556 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15182556
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AACGAAACCCAACAGGATAATAAACTCTAAATACTATAAGATTCAATTTTTAAAGATTCTAAGGAGAATGAATAGAAACAGTGAGAAGGATATGACAGAA[G/A]
TAAGGGGTAATAACTGGTGTGACTTTTAAAAACTATAAAATTAGAAGCACGGGGATGATAAGGTTTGGTCTTTCAAAGTTTTAAGATAACGAGATAACTA

Reverse complement sequence

TAGTTATCTCGTTATCTTAAAACTTTGAAAGACCAAACCTTATCATCCCCGTGCTTCTAATTTTATAGTTTTTAAAAGTCACACCAGTTATTACCCCTTA[C/T]
TTCTGTCATATCCTTCTCACTGTTTCTATTCATTCTCCTTAGAATCTTTAAAAATTGAATCTTATAGTATTTAGAGTTTATTATCCTGTTGGGTTTCGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	13.30%	0.28%	1.86%	NA
All Indica	2759	85.50%	14.30%	0.11%	0.07%	NA
All Japonica	1512	98.70%	0.10%	0.13%	1.12%	NA
Aus	269	17.80%	81.80%	0.37%	0.00%	NA
Indica I	595	85.00%	14.50%	0.50%	0.00%	NA
Indica II	465	80.40%	19.60%	0.00%	0.00%	NA
Indica III	913	88.90%	11.00%	0.00%	0.11%	NA
Indica Intermediate	786	84.90%	15.00%	0.00%	0.13%	NA
Temperate Japonica	767	97.90%	0.00%	0.13%	1.96%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	21.90%	3.10%	5.21%	69.79%	NA
Intermediate	90	85.60%	10.00%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015182556	G -> A	LOC_Os10g29150.1	downstream_gene_variant ; 96.0bp to feature; MODIFIER	silent_mutation	Average:26.666; most accessible tissue: Callus, score: 55.332	N	N	N	N
vg1015182556	G -> A	LOC_Os10g29159.1	downstream_gene_variant ; 4197.0bp to feature; MODIFIER	silent_mutation	Average:26.666; most accessible tissue: Callus, score: 55.332	N	N	N	N
vg1015182556	G -> A	LOC_Os10g29130-LOC_Os10g29150	intergenic_region ; MODIFIER	silent_mutation	Average:26.666; most accessible tissue: Callus, score: 55.332	N	N	N	N
vg1015182556	G -> DEL	N	N	silent_mutation	Average:26.666; most accessible tissue: Callus, score: 55.332	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015182556	NA	9.64E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	2.26E-07	3.19E-19	mr1317	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	3.07E-09	5.14E-19	mr1317	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	4.18E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	2.74E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	2.66E-06	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	9.50E-09	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	6.82E-09	3.25E-57	mr1855	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	2.53E-07	6.22E-31	mr1855	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	2.51E-15	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	4.01E-06	mr1897	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	5.40E-06	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	5.77E-12	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	6.51E-06	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	7.06E-06	NA	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	1.68E-06	1.29E-21	mr1317_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	1.29E-18	mr1317_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	3.41E-12	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	2.42E-09	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	6.15E-17	mr1610_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	2.30E-10	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	7.85E-06	2.17E-22	mr1818_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	1.04E-13	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	2.35E-11	1.11E-66	mr1855_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	2.22E-07	1.71E-32	mr1855_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	9.15E-21	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	3.74E-12	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	7.86E-06	5.83E-25	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	9.72E-19	mr1914_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	1.12E-27	mr1927_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182556	NA	1.42E-16	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251