\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014784092:

Variant ID: vg1014784092 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14784092
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GGGACGTTTCGCATCTAGGCCGCCGCGCCGTCGTGCATCGAGCCCGCCACCGCCGTCATGCATCCAGTCGCCGCCGTCGCGCATCCCTCCGCCGCCGTTG[C/T]
GCATCGACTGCCGCCGCCGTCGCGCATCTGGCTGCCCCTGCCTCTCGCGGTCTCGCTGCCCTCCCGACGATTTTTTCCCTCTCGTGAAACAGGAAATGAC

Reverse complement sequence

GTCATTTCCTGTTTCACGAGAGGGAAAAAATCGTCGGGAGGGCAGCGAGACCGCGAGAGGCAGGGGCAGCCAGATGCGCGACGGCGGCGGCAGTCGATGC[G/A]
CAACGGCGGCGGAGGGATGCGCGACGGCGGCGACTGGATGCATGACGGCGGTGGCGGGCTCGATGCACGACGGCGCGGCGGCCTAGATGCGAAACGTCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 7.50% 5.78% 1.88% NA
All Indica  2759 76.20% 12.40% 8.12% 3.23% NA
All Japonica  1512 99.00% 0.10% 0.86% 0.00% NA
Aus  269 89.60% 0.40% 10.04% 0.00% NA
Indica I  595 93.60% 1.30% 4.87% 0.17% NA
Indica II  465 46.70% 31.20% 15.27% 6.88% NA
Indica III  913 80.20% 9.90% 6.79% 3.18% NA
Indica Intermediate  786 76.00% 12.70% 7.89% 3.44% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 0.00% 0.99% 0.00% NA
Japonica Intermediate  241 96.70% 0.40% 2.90% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 82.20% 8.90% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014784092 C -> T LOC_Os10g28420.1 upstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:67.601; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg1014784092 C -> T LOC_Os10g28410-LOC_Os10g28420 intergenic_region ; MODIFIER silent_mutation Average:67.601; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg1014784092 C -> DEL N N silent_mutation Average:67.601; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014784092 NA 3.86E-10 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092 NA 1.54E-07 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092 NA 2.03E-15 mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092 NA 1.00E-13 mr1174_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092 NA 1.34E-12 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092 NA 2.60E-12 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092 NA 4.07E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251