\
| Variant ID: vg1014485975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14485975 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGAAACTAAAAAGGAAAAGATAAAGTTCTTATCGGACACTAAACACACTTTCCTAAAGATAAAAGAAAACTAACAAACTACGCCTAATTAATAGATAACT[G/A]
TCATGTCGTATCCTTCTTGAACTCGAACTCCGACGAGATCGAGCGGGGGGTCGGTGGTCTACGGGCTACAGCTTCGGATCCATCTGCATCGCCGGGATCA
TGATCCCGGCGATGCAGATGGATCCGAAGCTGTAGCCCGTAGACCACCGACCCCCCGCTCGATCTCGTCGGAGTTCGAGTTCAAGAAGGATACGACATGA[C/T]
AGTTATCTATTAATTAGGCGTAGTTTGTTAGTTTTCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCGATAAGAACTTTATCTTTTCCTTTTTAGTTTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 2.40% | 0.47% | 0.51% | NA |
| All Indica | 2759 | 95.00% | 4.10% | 0.80% | 0.11% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.90% | 0.00% | 0.00% | 7.06% | NA |
| Indica I | 595 | 81.30% | 15.30% | 3.36% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.50% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014485975 | G -> A | LOC_Os10g27470.1 | upstream_gene_variant ; 1158.0bp to feature; MODIFIER | silent_mutation | Average:74.227; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg1014485975 | G -> A | LOC_Os10g27460.1 | downstream_gene_variant ; 98.0bp to feature; MODIFIER | silent_mutation | Average:74.227; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg1014485975 | G -> A | LOC_Os10g27450-LOC_Os10g27460 | intergenic_region ; MODIFIER | silent_mutation | Average:74.227; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg1014485975 | G -> DEL | N | N | silent_mutation | Average:74.227; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014485975 | 2.51E-06 | 9.11E-12 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014485975 | 5.98E-09 | 8.90E-09 | mr1141 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014485975 | 4.50E-08 | 7.59E-15 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014485975 | 3.53E-08 | 3.50E-14 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014485975 | 4.55E-06 | 3.33E-12 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |