\
| Variant ID: vg1014230261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14230261 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )
TGTGCCTACTTGTCCACCAACACATGCAACATATAATTTTATCCACCACAAAAATATCATGCAGATCAAATTTGCTCTGAAACAGCAACAATTTTCAAAT[C/T]
CACCACAACCCTATTTTATTATGCGAGATATGACATGGAGAAAAATAGACACTACCACTCTAATAGTCCAGGTTACACTAGGTTATCAGATAGATCAAAA
TTTTGATCTATCTGATAACCTAGTGTAACCTGGACTATTAGAGTGGTAGTGTCTATTTTTCTCCATGTCATATCTCGCATAATAAAATAGGGTTGTGGTG[G/A]
ATTTGAAAATTGTTGCTGTTTCAGAGCAAATTTGATCTGCATGATATTTTTGTGGTGGATAAAATTATATGTTGCATGTGTTGGTGGACAAGTAGGCACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.90% | 37.30% | 0.25% | 0.49% | NA |
| All Indica | 2759 | 94.70% | 4.20% | 0.43% | 0.72% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.50% | 1.30% | 0.50% | 0.67% | NA |
| Indica II | 465 | 96.10% | 3.00% | 0.22% | 0.65% | NA |
| Indica III | 913 | 94.50% | 4.30% | 0.66% | 0.55% | NA |
| Indica Intermediate | 786 | 91.90% | 6.90% | 0.25% | 1.02% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 58.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014230261 | C -> T | LOC_Os10g26980.1 | upstream_gene_variant ; 3877.0bp to feature; MODIFIER | silent_mutation | Average:39.707; most accessible tissue: Callus, score: 79.874 | N | N | N | N |
| vg1014230261 | C -> T | LOC_Os10g26990.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.707; most accessible tissue: Callus, score: 79.874 | N | N | N | N |
| vg1014230261 | C -> DEL | N | N | silent_mutation | Average:39.707; most accessible tissue: Callus, score: 79.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014230261 | NA | 6.21E-69 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 3.42E-75 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 8.97E-22 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 3.68E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 4.21E-09 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.02E-22 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 3.74E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 5.87E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.68E-85 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 6.19E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 5.15E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 6.20E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.84E-41 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 7.12E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 7.74E-33 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 5.61E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.67E-37 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 3.05E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.77E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 6.50E-20 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 5.13E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 5.11E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.06E-70 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 2.37E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 2.86E-34 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.14E-10 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 3.49E-37 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 2.10E-46 | mr1591_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 3.88E-68 | mr1594_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 1.14E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 8.28E-23 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 6.49E-07 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 4.01E-24 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | 4.60E-06 | NA | mr1758_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 2.88E-09 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 2.90E-90 | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014230261 | NA | 3.30E-49 | mr1890_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |